AARS | GeneID:16 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 16 Official Symbol AARS
Locus N/A Gene Type protein-coding
Synonyms
Full Name alanyl-tRNA synthetase
Description alanyl-tRNA synthetase
Chromosome 16q22
Also Known As alanine tRNA ligase 1, cytoplasmic
Summary The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1213

ID Symbol Protein Species
GeneID:16 AARS NP_001596.2 Homo sapiens
GeneID:34156 Aats-ala NP_523511.2 Drosophila melanogaster
GeneID:171985 ars-2 NP_491281.1 Caenorhabditis elegans
GeneID:234734 Aars NP_666329.2 Mus musculus
GeneID:292023 Aars XP_214690.3 Rattus norvegicus
GeneID:324940 aars NP_001037775.1 Danio rerio
GeneID:415668 AARS NP_001005836.1 Gallus gallus
GeneID:454210 AARS XP_001169474.1 Pan troglodytes
GeneID:479656 AARS XP_536788.2 Canis lupus familiaris
GeneID:510933 AARS XP_588170.3 Bos taurus
GeneID:814313 PF13_0354 XP_001350388.1 Plasmodium falciparum
GeneID:841442 ALATS NP_175439.2 Arabidopsis thaliana
GeneID:854513 ALA1 NP_014980.1 Saccharomyces cerevisiae
GeneID:1279087 AgaP_AGAP009701 XP_318757.2 Anopheles gambiae
GeneID:2542031 SPAC23C11.09 NP_593640.1 Schizosaccharomyces pombe
GeneID:2676649 MGG_03607 XP_361064.2 Magnaporthe grisea
GeneID:2713811 NCU02566.1 XP_331765.1 Neurospora crassa
GeneID:2894909 KLLA0F02431g XP_455190.1 Kluyveromyces lactis
GeneID:4348211 Os10g0182000 NP_001064254.1 Oryza sativa
GeneID:4620624 AGOS_ADR363C NP_984459.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab50147 AlaRS antibody (ab50147); Rabbit polyclonal to AlaRS
2 abgent AP7558a AARS Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
3 acris AP14199PU-N AARS (N-term); antibody Ab
4 scbt AARS AARS Antibody / AARS Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of AARS Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AARS Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005625 Component soluble fraction
GO:0004813 Function alanine-tRNA ligase activity
GO:0005524 Function ATP binding
GO:0016874 Function ligase activity
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0000049 Function tRNA binding
GO:0006419 Process alanyl-tRNA aminoacylation
GO:0021680 Process cerebellar Purkinje cell layer development
GO:0030968 Process endoplasmic reticulum unfolded protein response
GO:0001942 Process hair follicle development
GO:0043524 Process negative regulation of neuron apoptosis
GO:0050885 Process neuromuscular process controlling balance
GO:0006457 Process protein folding
GO:0043200 Process response to amino acid stimulus
GO:0043588 Process skin development
GO:0006412 Process translation
GO:0043039 Process tRNA aminoacylation
GO:0006400 Process tRNA modification

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001605  UCSC Browser NP_001596

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000261772 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000261772 MI0000446 hsa-miR-125b-1* ACGGGUUAGGCUCUUGGGAGCU
ENST00000261772 MI0000472 hsa-miR-127-3p UCGGAUCCGUCUGAGCUUGGCU
ENST00000261772 MI0000456 hsa-miR-140-5p CAGUGGUUUUACCCUAUGGUAG
ENST00000261772 MI0000461 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENST00000261772 MI0000479 hsa-miR-150 UCUCCCAACCCUUGUACCAGUG
ENST00000261772 MI0000809 hsa-miR-151-3p CUAGACUGAAGCUCCUUGAGG
ENST00000261772 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000261772 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000261772 MI0000071 hsa-miR-17* ACUGCAGUGAAGGCACUUGUAG
ENST00000261772 MI0000269 hsa-miR-181a-2* ACCACUGACCGUUGACUGUACC
ENST00000261772 MI0000272 hsa-miR-182* UGGUUCUAGACUUGCCAACUA
ENST00000261772 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENST00000261772 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENST00000261772 MI0000732 hsa-miR-194* CCAGUGGGGCUGCUGUUAUCUG
ENST00000261772 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000261772 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENST00000261772 MI0005569 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA
ENST00000261772 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000261772 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000261772 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000261772 MI0000085 hsa-miR-27a* AGGGCUUAGCUGCUUGUGAGCA
ENST00000261772 MI0000440 hsa-miR-27b* AGAGCUUAGCUGAUUGGUGAAC
ENST00000261772 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000261772 MI0000735 hsa-miR-29c* UGACCGAUUUCUCCUGGUGUUC
ENST00000261772 MI0000090 hsa-miR-32 UAUUGCACAUUACUAAGUUGCA
ENST00000261772 MI0000764 hsa-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENST00000261772 MI0000764 hsa-miR-363* CGGGUGGAUCACGAUGCAAUUU
ENST00000261772 MI0000775 hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENST00000261772 MI0000777 hsa-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENST00000261772 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000261772 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENST00000261772 MI0003685 hsa-miR-421 AUCAACAGACAUUAAUUGGGCGC
ENST00000261772 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENST00000261772 MI0003133 hsa-miR-432* CUGGAUGGCUCCUCCAUGUCU
ENST00000261772 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000261772 MI0003136 hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENST00000261772 MI0003138 hsa-miR-497 CAGCAGCACACUGUGGUUUGU
ENST00000261772 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000261772 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000261772 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000261772 MI0003161 hsa-miR-517* CCUCUAGAUGGAAGCACUGUCU
ENST00000261772 MI0003165 hsa-miR-517* CCUCUAGAUGGAAGCACUGUCU
ENST00000261772 MI0003174 hsa-miR-517* CCUCUAGAUGGAAGCACUGUCU
ENST00000261772 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000261772 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000261772 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENST00000261772 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENST00000261772 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENST00000261772 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENST00000261772 MI0003516 hsa-miR-545 UCAGCAAACAUUUAUUGUGUGC
ENST00000261772 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENST00000261772 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENST00000261772 MI0003581 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENST00000261772 MI0003585 hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU
ENST00000261772 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENST00000261772 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENST00000261772 MI0003644 hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU
ENST00000261772 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENST00000261772 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENST00000261772 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENST00000261772 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENST00000261772 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENST00000261772 MI0000093 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000261772 MI0000094 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000261772 MI0003560 hsa-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENST00000261772 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENST00000261772 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000261772 MI0000101 hsa-miR-99a* CAAGCUCGCUUCUAUGGGUCUG
ENST00000261772 MI0000746 hsa-miR-99b* CAAGCUCGUGUCUGUGGGUCCG
ENST00000261772 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENST00000261772 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENST00000261772 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENST00000261772 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000261772 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000261772 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENST00000261772 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000261772 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000261772 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000261772 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENST00000261772 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENST00000261772 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENST00000261772 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENST00000261772 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENST00000261772 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA
ENST00000261772 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
4-phenylbutyric acid
  • 4-phenylbutyric acid results in decreased expression of AARS mRNA
  • 4-phenylbutyric acid results in increased expression of AARS mRNA
14583596
Acetaminophen
  • Acetaminophen affects the expression of AARS mRNA
17562736

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17562736, 17522070, 16177239, 15968718, 16227642, 14986274
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  2. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  3. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  4. [ + ] Sang Lee J, et al. (2002) "Interaction network of human aminoacyl-tRNA synthetases and subunits of elongation factor 1 complex." Biochem Biophys Res Commun. 291(1):158-164. PMID:11829477
  5. [ + ] Lovato MA, et al. (2001) "Translocation within the acceptor helix of a major tRNA identity determinant." EMBO J. 20(17):4846-4853. PMID:11532948
  6. [ + ] Scanlan MJ, et al. (1999) "Antigens recognized by autologous antibody in patients with renal-cell carcinoma." Int J Cancer. 83(4):456-464. PMID:10508479
  7. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  8. [ + ] Nichols RC, et al. (1995) "Localization of two human autoantigen genes by PCR screening and in situ hybridization--glycyl-tRNA synthetase locates to 7p15 and alanyl-tRNA synthetase locates to 16q22." Genomics. 30(1):131-132. PMID:8595897
  9. [ + ] Ripmaster TL, et al. (1995) "Wide cross-species aminoacyl-tRNA synthetase replacement in vivo: yeast cytoplasmic alanine enzyme replaced by human polymyositis serum antigen." Proc Natl Acad Sci U S A. 92(11):4932-4936. PMID:7761427
  10. [ + ] Shiba K, et al. (1995) "Human alanyl-tRNA synthetase: conservation in evolution of catalytic core and microhelix recognition." Biochemistry. 34(33):10340-10349. PMID:7654687
  11. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298
  12. [ + ] Matoba R, et al. (1994) "The addition of 5'-coding information to a 3'-directed cDNA library improves analysis of gene expression." Gene. 146(2):199-207. PMID:8076819
  13. [ + ] Francklyn C, et al. (1989) "Aminoacylation of RNA minihelices with alanine." Nature. 337(6206):478-481. PMID:2915692