ABCA13 | GeneID:154664 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 154664 Official Symbol ABCA13
Locus N/A Gene Type protein-coding
Synonyms DKFZp313D2411; FLJ16398; FLJ33876; FLJ33951
Full Name ATP-binding cassette, sub-family A (ABC1), member 13
Description ATP-binding cassette, sub-family A (ABC1), member 13
Chromosome 7p12.3
Also Known As ATP binding cassette transporter A13; ATP binding cassette, sub-family A (ABC1), member 13
Summary In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 27991

ID Symbol Protein Species
GeneID:154664 ABCA13 NP_689914.2 Homo sapiens
GeneID:268379 Abca13 NP_839990.2 Mus musculus
GeneID:289797 Abca13 XP_223625.4 Rattus norvegicus
GeneID:463404 ABCA13 XP_519092.2 Pan troglodytes
GeneID:522756 ABCA13 XP_601044.3 Bos taurus
GeneID:606966 ABCA13 XP_848555.1 Canis lupus familiaris

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCA13 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCA13 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_152701  UCSC Browser NP_689914

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000319379 MI0000299 hsa-miR-222 AGCUACAUCUGGCUACUGGGU
ENST00000319379 MI0003664 hsa-miR-649 AAACCUGUGUUGUUCAAGAGUC
ENST00000319379 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000319379 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENST00000319379 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Arbutin
  • Arbutin results in decreased expression of ABCA13 mRNA
17103032
kojic acid
  • kojic acid results in decreased expression of ABCA13 mRNA
16595896

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] de Krom M, et al. (2009) "A common variant in DRD3 receptor is associated with autism spectrum disorder." Biol Psychiatry. 65(7):625-630. PMID:19058789
  2. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  3. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  4. [ + ] Prades C, et al. (2002) "The human ATP binding cassette gene ABCA13, located on chromosome 7p12.3, encodes a 5058 amino acid protein with an extracellular domain encoded in part by a 4.8-kb conserved exon." Cytogenet Genome Res. 98(2-3):160-168. PMID:12697998