AANAT | GeneID:15 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 15 Official Symbol AANAT
Locus N/A Gene Type protein-coding
Synonyms AA-NAT; SNAT
Full Name arylalkylamine N-acetyltransferase
Description arylalkylamine N-acetyltransferase
Chromosome 17q25
Also Known As serotonin N-acetyltransferase
Summary Arylalkylamine N-acetyltransferase belongs to the superfamily of acetyltransferases. It is the penultimate enzyme in melatonin synthesis and controls the night/day rhythm in melatonin production in the vertebrate pineal gland. Melatonin is essential for seasonal reproduction, modulates the function of the circadian clock in the suprachiasmatic nucleus, and influences activity and sleep. This enzyme is rapidly inactivated when animals are exposed to light at night. This protein is 80% identical to sheep and rat AA-NAT. Arylalkylamine N-acetyltransferase may contribute a multifactorial genetic diseases such as altered behavior in sleep/wake cycle. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31013

ID Symbol Protein Species
GeneID:15 AANAT NP_001079.1 Homo sapiens
GeneID:11298 Aanat NP_033721.1 Mus musculus
GeneID:25120 Aanat NP_036950.1 Rattus norvegicus
GeneID:281583 AANAT NP_803475.1 Bos taurus
GeneID:393677 aanat1 NP_956998.1 Danio rerio
GeneID:396066 AANAT NP_990489.1 Gallus gallus
GeneID:483331 AANAT XP_540450.1 Canis lupus familiaris
GeneID:503504 AANAT NP_001012442.1 Pan troglodytes
GeneID:618594 AANAT XP_876019.2 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab3505 Serotonin N-acetyltransferase antibody (ab3505); Rabbit polyclonal to Serotonin N-acetyltransferase
2 abcam ab3439 Serotonin N-acetyltransferase (phospho T29) antibody (ab3439); Rabbit polyclonal to Serotonin N-acetyltransferase (phospho T29)
3 abcam ab2183 AANAT antibody (ab2183); Rabbit polyclonal to AANAT
4 scbt AANAT AANAT Antibody / AANAT Antibodies;
5 sigma S0564 Anti-Serotonin N-Acetyltransferase (N-Terminal) antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of AANAT Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AANAT Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0008415 Function acyltransferase activity
GO:0004059 Function aralkylamine N-acetyltransferase activity
GO:0004060 Function arylamine N-acetyltransferase activity
GO:0005184 Function neuropeptide hormone activity
GO:0016740 Function transferase activity
GO:0007623 Process circadian rhythm
GO:0030187 Process melatonin biosynthetic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001088  UCSC Browser NP_001079

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000250615 MI0000446 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000250615 MI0000470 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000250615 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENST00000250615 MI0000475 hsa-miR-136 ACUCCAUUUGUUUUGAUGAUGGA
ENST00000250615 MI0000261 hsa-miR-139-3p GGAGACGCGGCCCUGUUGGAGU
ENST00000250615 MI0003129 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG
ENST00000250615 MI0000809 hsa-miR-151-5p UCGAGGAGCUCACAGUCUAGU
ENST00000250615 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000250615 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000250615 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000250615 MI0000082 hsa-miR-25* AGGCGGAGACUUGGGCAAUUG
ENST00000250615 MI0000084 hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC
ENST00000250615 MI0000086 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG
ENST00000250615 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENST00000250615 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENST00000250615 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000250615 MI0005531 hsa-miR-450b-3p UUGGGAUCAUUUUGCAUCCAUA
ENST00000250615 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENST00000250615 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000250615 MI0003159 hsa-miR-518c* UCUCUGGAGGGAAGCACUUUCUG
ENST00000250615 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENST00000250615 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENST00000250615 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENST00000250615 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENST00000250615 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENST00000250615 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENST00000250615 MI0005543 hsa-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENST00000250615 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENST00000250615 MI0005561 hsa-miR-877 GUAGAGGAGAUGGCGCAGGG
ENST00000250615 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000250615 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENST00000250615 MI0000098 hsa-miR-96* AAUCAUGUGCAGUGCCAAUAUG
ENST00000250615 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENST00000250615 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENST00000250615 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENST00000250615 MI0004646 mmu-miR-683 CCUGCUGUAAGCUGUGUCCUC
ENST00000250615 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENST00000250615 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG
ENST00000250615 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENST00000250615 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA
ENST00000250615 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENST00000250615 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
calyculin A
  • calyculin A results in decreased activity of AANAT protein
11442772
cypermethrin
  • cypermethrin does not affect the activity of AANAT protein
11442772
dephostatin
  • dephostatin does not affect the activity of AANAT protein
11442772
Isoproterenol
  • [Puromycin co-treated with Isoproterenol] does not affect the expression of AANAT mRNA
15773915
Okadaic Acid
  • Okadaic Acid results in decreased activity of AANAT protein
  • Okadaic Acid results in decreased expression of AANAT mRNA
11442772
Puromycin
  • Puromycin does not affect the expression of AANAT mRNA
  • [Puromycin co-treated with Isoproterenol] does not affect the expression of AANAT mRNA
15773915
Serotonin
  • AANAT protein binds to and results in increased acylation of Serotonin
15644438
Uranium
  • Uranium affects the expression of AANAT mRNA
15672453
uranyl acetate
  • uranyl acetate affects the expression of AANAT mRNA
15672453

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Sleep Disorders marker
Glioblastoma inferred via Okadaic Acid 17312396
Myocardial Infarction inferred via Isoproterenol 15740881
Agricultural Workers' Diseases inferred via cypermethrin 16487989
Dyspnea inferred via cypermethrin 16487989
Hepatitis inferred via cypermethrin 16487989
Insect Bites and Stings inferred via cypermethrin 15189238
Liver Diseases inferred via cypermethrin 15991261
Urologic Diseases inferred via cypermethrin 16487989

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
YWHAZ YWHAZ / AANAT Co-crystal Structure Obsil T (2001)
YWHAZ YWHAZ / AANAT Co-purification Obsil T (2001)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Anderson BM, et al. (2009) "Examination of association of genes in the serotonin system to autism." Neurogenetics. 10(3):209-216. PMID:19184136
  3. [ + ] Blomeke B, et al. (2008) "Arylalkylamine N-acetyltransferase (AANAT) genotype as a personal trait in melatonin synthesis." J Toxicol Environ Health A. 71(13-14):874-876. PMID:18569588
  4. [ + ] Wang H, et al. (2008) "Association study of tryptophan hydroxylase 1 and arylalkylamine N-acetyltransferase polymorphisms with adolescent idiopathic scoliosis in Han Chinese." Spine. 33(20):2199-2203. PMID:18794762
  5. [ + ] Pereira DS, et al. (2007) "The G619A Aa-nat gene polymorphism does not contribute to sleep time variation in the Brazilian population." Behav Genet. 37(4):637-638. PMID:17503170
  6. [ + ] Klein DC, et al. (2007) "Arylalkylamine N-acetyltransferase: "the Timezyme"." J Biol Chem. 282(7):4233-4237. PMID:17164235
  7. [ + ] Wang GY, et al. (2004) "Genetic variability of arylalkylamine-N-acetyl-transferase (AA-NAT) gene and human sleep/wake pattern." Chronobiol Int. 21(2):229-237. PMID:15332344
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Ying GW, et al. (2004) "A naturally occurring -263G/C variant of the human AA-NAT gene and overnight melatonin production." Mol Genet Metab. 81(1):65-69. PMID:14728993
  10. [ + ] Hohjoh H, et al. (2003) "Significant association of the arylalkylamine N-acetyltransferase ( AA-NAT) gene with delayed sleep phase syndrome." Neurogenetics. 4(3):151-153. PMID:12736803
  11. [ + ] Wang CY, et al. (2002) "Correlation of the genotypes for N-acetyltransferases 1 and 2 with double bladder and prostate cancers in a case-comparison study." Anticancer Res. 22(6B):3529-3535. PMID:12552951
  12. [ + ] Wu FY, et al. (2002) "Association of DNA-protein crosslinks and breast cancer." Mutat Res. 501(1-2):69-78. PMID:11934439
  13. [ + ] Slominski A, et al. (2002) "Serotoninergic and melatoninergic systems are fully expressed in human skin." FASEB J. 16(8):896-898. PMID:12039872
  14. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  15. [ + ] Ganguly S, et al. (2001) "Role of a pineal cAMP-operated arylalkylamine N-acetyltransferase/14-3-3-binding switch in melatonin synthesis." Proc Natl Acad Sci U S A. 98(14):8083-8088. PMID:11427721
  16. [ + ] Sekine A, et al. (2001) "Identification of single-nucleotide polymorphisms (SNPs) of human N-acetyltransferase genes NAT1, NAT2, AANAT, ARD1 and L1CAM in the Japanese population." J Hum Genet. 46(6):314-319. PMID:11393533
  17. [ + ] Obsil T, et al. (2001) "Crystal structure of the 14-3-3zeta:serotonin N-acetyltransferase complex. a role for scaffolding in enzyme regulation." Cell. 105(2):257-267. PMID:11336675
  18. [ + ] Coon SL, et al. (2001) "cAmp regulation of arylalkylamine N-acetyltransferase (AANAT, EC 2.3.1.87): a new cell line (1E7) provides evidence of intracellular AANAT activation." J Biol Chem. 276(26):24097-24107. PMID:11313340
  19. [ + ] Klein DC, et al. (1997) "The melatonin rhythm-generating enzyme: molecular regulation of serotonin N-acetyltransferase in the pineal gland." Recent Prog Horm Res. 52():307-57; discussion 357. PMID:9238858
  20. [ + ] Coon SL, et al. (1996) "The human serotonin N-acetyltransferase (EC 2.3.1.87) gene (AANAT): structure, chromosomal localization, and tissue expression." Genomics. 34(1):76-84. PMID:8661026
  21. [ + ] Coon SL, et al. (1995) "Pineal serotonin N-acetyltransferase: expression cloning and molecular analysis." Science. 270(5242):1681-1683. PMID:7502081
  22. [ + ] Roseboom PH, et al. (1994) "Cloning and characterization of the epsilon and zeta isoforms of the 14-3-3 proteins." DNA Cell Biol. 13(6):629-640. PMID:8024705
  23. [ + ] Smith TJ, et al. (1990) "Phylogenetic distribution and function of arylalkylamine N-acetyltransferase." Bioessays. 12(1):30-33. PMID:2181999