EME1 | GeneID:146956 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 146956 Official Symbol EME1
Locus N/A Gene Type protein-coding
Synonyms FLJ31364; MMS4L
Full Name essential meiotic endonuclease 1 homolog 1 (S. pombe)
Description essential meiotic endonuclease 1 homolog 1 (S. pombe)
Chromosome 17q21.33
Also Known As essential meiotic endonuclease 1 homolog 1; essential meiotic endonuclease 1 homolog 2; homolog of yeast EME1 endonuclease
Summary EME1 and MUS81 (MIM 606591) form an endonuclease complex that cleaves branched DNA structures, especially those arising during stalled DNA replication (Abraham et al., 2003 [PubMed 14609959]).[supplied by OMIM]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 16123

ID Symbol Protein Species
GeneID:36136 CG12936 NP_610611.1 Drosophila melanogaster
GeneID:146956 EME1 NP_689676.1 Homo sapiens
GeneID:268465 Eme1 NP_808420.1 Mus musculus
GeneID:287634 Eme1 XP_220879.2 Rattus norvegicus
GeneID:491079 EME1 XP_852400.1 Canis lupus familiaris
GeneID:558350 wu:fc30c07 XP_707096.1 Danio rerio
GeneID:747125 EME1 XP_001169575.1 Pan troglodytes
GeneID:1273666 AgaP_AGAP002302 XP_312668.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abgent AP6288a EME1 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
2 abgent AP6288c EME1 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
3 acris AP13292PU-N EME1 (N-term); antibody Ab
4 acris AP13293PU-N EME1 (Center); antibody Ab
5 acris BM4535 EME1 / MMS4; antibody Ab
6 scbt EME1 EME1 Antibody / EME1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of EME1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of EME1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0003677 Function DNA binding
GO:0004519 Function endonuclease activity
GO:0016787 Function hydrolase activity
GO:0000287 Function magnesium ion binding
GO:0005515 Function protein binding
GO:0006310 Process DNA recombination
GO:0006281 Process DNA repair
GO:0006974 Process response to DNA damage stimulus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_152463  UCSC Browser NP_689676

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000338165 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000338165 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000338165 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000338165 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000338165 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000338165 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENST00000338165 MI0000103 hsa-miR-101* CAGUUAUCACAGUGCUGAUGCU
ENST00000338165 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENST00000338165 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENST00000338165 MI0000470 hsa-miR-125b-2* UCACAAGUCAGGCUCUUGGGAC
ENST00000338165 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENST00000338165 MI0000809 hsa-miR-151-3p CUAGACUGAAGCUCCUUGAGG
ENST00000338165 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000338165 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000338165 MI0000269 hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENST00000338165 MI0000289 hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENST00000338165 MI0000270 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000338165 MI0000683 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000338165 MI0003139 hsa-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENST00000338165 MI0000073 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENST00000338165 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000338165 MI0000088 hsa-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENST00000338165 MI0000749 hsa-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENST00000338165 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENST00000338165 MI0000816 hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC
ENST00000338165 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENST00000338165 MI0000268 hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENST00000338165 MI0000742 hsa-miR-34b* UAGGCAGUGUCAUUAGCUGAUUG
ENST00000338165 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000338165 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000338165 MI0000782 hsa-miR-374a UUAUAAUACAACCUGAUAAGUG
ENST00000338165 MI0005566 hsa-miR-374b AUAUAAUACAACCUGCUAAGUG
ENST00000338165 MI0001445 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENST00000338165 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000338165 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000338165 MI0002468 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENST00000338165 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000338165 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENST00000338165 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENST00000338165 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENST00000338165 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENST00000338165 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENST00000338165 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENST00000338165 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENST00000338165 MI0005532 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENST00000338165 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENST00000338165 MI0000101 hsa-miR-99a AACCCGUAGAUCCGAUCUUGUG
ENST00000338165 MI0000746 hsa-miR-99b CACCCGUAGAACCGACCUUGCG
ENST00000338165 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENST00000338165 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENST00000338165 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000338165 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000338165 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000338165 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000338165 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000338165 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000338165 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENST00000338165 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENST00000338165 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENST00000338165 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENST00000338165 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENST00000338165 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENST00000338165 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of EME1 mRNA
17562736
glycidamide
  • glycidamide results in increased expression of EME1 mRNA
17822822

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Hepatitis, Toxic inferred via Acetaminophen 2444490, 14986274, 17562736, 17522070, 16081117, 16177239, 15968718, 16227642
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
MUS81 MUS81 / EME1 Reconstituted Complex Ciccia A (2003)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Tomoda Y, et al. (2009) "Functional evidence for Eme1 as a marker of cisplatin resistance." Int J Cancer. 124(12):2997-3001. PMID:19267403
  2. [ + ] Taylor ER, et al. (2008) "Cleavage mechanism of human Mus81-Eme1 acting on Holliday-junction structures." Proc Natl Acad Sci U S A. 105(10):3757-3762. PMID:18310322
  3. [ + ] Mazina OM, et al. (2008) "Human Rad54 protein stimulates human Mus81-Eme1 endonuclease." Proc Natl Acad Sci U S A. 105(47):18249-18254. PMID:19017809
  4. [ + ] Chang JS, et al. (2008) "Pathway analysis of single-nucleotide polymorphisms potentially associated with glioblastoma multiforme susceptibility using random forests." Cancer Epidemiol Biomarkers Prev. 17(6):1368-1373. PMID:18559551
  5. [ + ] Chang JH, et al. (2008) "Crystal structure of the Mus81-Eme1 complex." Genes Dev. 22(8):1093-1106. PMID:18413719
  6. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  7. [ + ] Hiyama T, et al. (2006) "Haploinsufficiency of the Mus81-Eme1 endonuclease activates the intra-S-phase and G2/M checkpoints and promotes rereplication in human cells." Nucleic Acids Res. 34(3):880-892. PMID:16456034
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Blais V, et al. (2004) "RNA interference inhibition of Mus81 reduces mitotic recombination in human cells." Mol Biol Cell. 15(2):552-562. PMID:14617801
  10. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  11. [ + ] Beausoleil SA, et al. (2004) "Large-scale characterization of HeLa cell nuclear phosphoproteins." Proc Natl Acad Sci U S A. 101(33):12130-12135. PMID:15302935
  12. [ + ] Abraham J, et al. (2003) "Eme1 is involved in DNA damage processing and maintenance of genomic stability in mammalian cells." EMBO J. 22(22):6137-6147. PMID:14609959
  13. [ + ] Ciccia A, et al. (2003) "Identification and characterization of the human mus81-eme1 endonuclease." J Biol Chem. 278(27):25172-25178. PMID:12721304
  14. [ + ] Ogrunc M, et al. (2003) "Identification and characterization of human MUS81-MMS4 structure-specific endonuclease." J Biol Chem. 278(24):21715-21720. PMID:12686547
  15. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932