ABHD12B | GeneID:145447 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 145447 Official Symbol ABHD12B
Locus N/A Gene Type protein-coding
Synonyms BEM46L3; C14orf29; MGC129926; MGC129927; c14_5314
Full Name abhydrolase domain containing 12B
Description abhydrolase domain containing 12B
Chromosome 14q22.1
Also Known As OTTHUMP00000178964
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 45643

ID Symbol Protein Species
GeneID:145447 ABHD12B NP_861535.1 Homo sapiens
GeneID:328121 Abhd12b XP_001475516.1 Mus musculus
GeneID:408202 Bem46l3 NP_001003928.1 Rattus norvegicus
GeneID:467453 ABHD12B XP_522850.2 Pan troglodytes
GeneID:555902 LOC555902 XP_683654.2 Danio rerio
GeneID:610765 ABHD12B XP_853408.1 Canis lupus familiaris
GeneID:751622 si:ch211-117n7.7 NP_001038808.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma HPA002873 Anti-ABHD12B antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABHD12B Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABHD12B Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005634 Component nucleus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_181533  UCSC Browser NP_853511
2 NM_181814  UCSC Browser NP_861535

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000337334 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000337334 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000337334 MI0000443 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000337334 MI0000444 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000337334 MI0000445 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000337334 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENST00000337334 MI0000271 hsa-miR-181c* AACCAUCGACCGUUGAGUGGAC
ENST00000337334 MI0000077 hsa-miR-21 UAGCUUAUCAGACUGAUGUUGA
ENST00000337334 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENST00000337334 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENST00000337334 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENST00000337334 MI0000784 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000337334 MI0003529 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000337334 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENST00000337334 MI0003123 hsa-miR-488* CCCAGAUAAUGGCACUCUCAA
ENST00000337334 MI0003183 hsa-miR-499-3p AACAUCACAGCAAGUCUGUGCU
ENST00000337334 MI0005565 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU
ENST00000337334 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENST00000337334 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENST00000337334 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENST00000337334 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENST00000337334 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENST00000337334 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000337334 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENST00000337334 MI0003639 hsa-miR-625* GACUAUAGAACUUUCCCCCUCA
ENST00000337334 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENST00000337334 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENST00000337334 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENST00000337334 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000337334 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000337334 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENST00000337334 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000337334 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000337334 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG
ENST00000337334 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENST00000337334 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  2. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932