A2ML1 | GeneID:144568 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 144568 Official Symbol A2ML1
Locus N/A Gene Type protein-coding
Synonyms CPAMD9; DKFZp686C1729; DKFZp686D2011; DKFZp686G1812; DKFZp686L1821; DKFZp686O1010; FLJ16045; FLJ25179; FLJ39129; FLJ41597; FLJ41598; FLJ41607
Full Name alpha-2-macroglobulin-like 1
Description alpha-2-macroglobulin-like 1
Chromosome 12p13.31
Also Known As C3 and PZP-like, alpha-2-macroglobulin domain containing 9; OTTHUMP00000158614
Summary The alpha-macroglobulin (AM) superfamily of proteins contains both complement components and protease inhibitors, including A2M (MIM 103950) and A2ML1. AM proteins display a unique trap mechanism of inhibition, by which the AM inhibitor undergoes a major conformational change upon its cleavage by a protease, thus trapping the protease and blocking it from subsequent substrate binding (Galliano et al., 2006 [PubMed 16298998]).[supplied by OMIM]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 67167

ID Symbol Protein Species
GeneID:144568 A2ML1 NP_653271.2 Homo sapiens
GeneID:407643 LOC407643 XP_001920744.1 Danio rerio
GeneID:418254 A2ML1 XP_416480.2 Gallus gallus
GeneID:465375 A2ML1 XP_520828.2 Pan troglodytes
GeneID:486697 A2ML1 XP_543824.2 Canis lupus familiaris

Exon, Intron and UTRs

Exon, Intron and UTRs of A2ML1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of A2ML1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0005615 Component extracellular space
GO:0005515 Function protein binding
GO:0004867 Function serine-type endopeptidase inhibitor activity
GO:0052548 Process regulation of endopeptidase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_144670  UCSC Browser NP_653271

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000311537 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000311537 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000311537 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000311537 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000311537 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000311537 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000311537 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000311537 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000311537 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000311537 MI0000434 hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENST00000311537 MI0000113 hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAG
ENST00000311537 MI0000734 hsa-miR-106b UAAAGUGCUGACAGUGCAGAU
ENST00000311537 MI0000457 hsa-miR-141* CAUCUUCCAGUACAGUGUUGGA
ENST00000311537 MI0000459 hsa-miR-143* GGUGCAGUGCUGCAUCUCUGGU
ENST00000311537 MI0000809 hsa-miR-151-3p CUAGACUGAAGCUCCUUGAGG
ENST00000311537 MI0000071 hsa-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENST00000311537 MI0001518 hsa-miR-18b* UGCCCUAAAUGCCCCUUCUGGC
ENST00000311537 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000311537 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000311537 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000311537 MI0000076 hsa-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENST00000311537 MI0001519 hsa-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENST00000311537 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENST00000311537 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENST00000311537 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENST00000311537 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENST00000311537 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENST00000311537 MI0000786 hsa-miR-378* CUCCUGACUCCAGGUCCUGUGU
ENST00000311537 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENST00000311537 MI0003189 hsa-miR-504 AGACCCUGGUCUGCACUCUAUC
ENST00000311537 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENST00000311537 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENST00000311537 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENST00000311537 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENST00000311537 MI0003516 hsa-miR-545* UCAGUAAAUGUUUAUUAGAUGA
ENST00000311537 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENST00000311537 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENST00000311537 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENST00000311537 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000311537 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENST00000311537 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENST00000311537 MI0003632 hsa-miR-618 AAACUCUACUUGUCCUUCUGAGU
ENST00000311537 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENST00000311537 MI0000095 hsa-miR-93 CAAAGUGCUGUUCGUGCAGGUAG
ENST00000311537 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENST00000311537 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENST00000311537 MI0000100 hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENST00000311537 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENST00000311537 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENST00000311537 MI0005203 mmu-miR-804 UGUGAGUUGUUCCUCACCUGGA
ENST00000311537 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENST00000311537 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Galliano MF, et al. (2008) "Binding of alpha2ML1 to the low density lipoprotein receptor-related protein 1 (LRP1) reveals a new role for LRP1 in the human epidermis." PLoS ONE. 3(7):e2729. PMID:18648652
  2. [ + ] Toulza E, et al. (2007) "Large-scale identification of human genes implicated in epidermal barrier function." Genome Biol. 8(6):R107. PMID:17562024
  3. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  4. [ + ] Galliano MF, et al. (2006) "A novel protease inhibitor of the alpha2-macroglobulin family expressed in the human epidermis." J Biol Chem. 281(9):5780-5789. PMID:16298998
  5. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  6. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  7. [ + ] Dias Neto E, et al. (2000) "Shotgun sequencing of the human transcriptome with ORF expressed sequence tags." Proc Natl Acad Sci U S A. 97(7):3491-3496. PMID:10737800