CSE1L | GeneID:1434 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 1434 | Official Symbol | CSE1L |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | CAS; CSE1; MGC117283; MGC130036; MGC130037; XPO2 | ||
| Full Name | CSE1 chromosome segregation 1-like (yeast) | ||
| Description | CSE1 chromosome segregation 1-like (yeast) | ||
| Chromosome | 20q13 | ||
| Also Known As | CSE1 chromosome segregation 1-like protein; OTTHUMP00000043373; cellular apoptosis susceptibility protein; chromosome segregation 1-like; importin-alpha re-exporter | ||
| Summary | Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 1006
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:1434 | CSE1L | NP_001307.2 | Homo sapiens |
| GeneID:30707 | cse1l | NP_958858.1 | Danio rerio |
| GeneID:35016 | Cas | NP_523588.2 | Drosophila melanogaster |
| GeneID:110750 | Cse1l | NP_076054.1 | Mus musculus |
| GeneID:362273 | Cse1l | XP_342582.1 | Rattus norvegicus |
| GeneID:419212 | CSE1L | XP_417389.2 | Gallus gallus |
| GeneID:458318 | CSE1L | XP_001166085.1 | Pan troglodytes |
| GeneID:477257 | CSE1L | XP_853206.1 | Canis lupus familiaris |
| GeneID:518622 | CSE1L | NP_001014933.1 | Bos taurus |
| GeneID:819263 | AT2G46520 | NP_182175.1 | Arabidopsis thaliana |
| GeneID:852612 | CSE1 | NP_011276.1 | Saccharomyces cerevisiae |
| GeneID:1272510 | AgaP_AGAP010711 | XP_311424.1 | Anopheles gambiae |
| GeneID:2540419 | kap109 | NP_595530.1 | Schizosaccharomyces pombe |
| GeneID:2677245 | MGG_03994 | XP_361520.2 | Magnaporthe grisea |
| GeneID:2705451 | NCU04104.1 | XP_323444.1 | Neurospora crassa |
| GeneID:2896506 | KLLA0A00869g | XP_451037.1 | Kluyveromyces lactis |
| GeneID:4327779 | Os01g0235400 | NP_001042522.1 | Oryza sativa |
| GeneID:4622083 | AGOS_AFR273W | NP_985820.1 | Eremothecium gossypii |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab70547 | Cellular Apoptosis Susceptibility antibody (ab70547); Rabbit polyclonal to Cellular Apoptosis Susceptibility |
| 2 | abcam | ab54674 | Cellular Apoptosis Susceptibility antibody (ab54674); Mouse monoclonal to Cellular Apoptosis Susceptibility |
| 3 | abcam | ab52232 | Cellular Apoptosis Susceptibility antibody (ab52232); Rabbit polyclonal to Cellular Apoptosis Susceptibility |
| 4 | abcam | ab50844 | Cellular Apoptosis Susceptibility antibody [30F12] (ab50844); Mouse monoclonal [30F12] to Cellular Apoptosis Susceptibility |
| 5 | abcam | ab27518 | Cellular Apoptosis Susceptibility antibody (ab27518); Rabbit polyclonal to Cellular Apoptosis Susceptibility |
| 6 | abcam | ab27519 | Cellular Apoptosis Susceptibility antibody, prediluted (ab27519); Rabbit polyclonal to Cellular Apoptosis Susceptibility, prediluted |
| 7 | abgent | AP1935a | CSE1L Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab) |
| 8 | abgent | AP1935b | CSE1L Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab) |
| 9 | acris | AP15390PU-S | XPO2 / Exportin-2 (N-term); antibody Ab |
| 10 | acris | AP11742PU-N | XPO2 / Exportin-2 (N-term); antibody Ab |
| 11 | acris | AP11743PU-N | XPO2 / Exportin-2 (C-term); antibody Ab |
| 12 | acris | AP06076PU-N | XPO2 / Exportin-2; antibody Ab |
| 13 | acris | AP07242PU-N | XPO2 / Exportin-2; antibody Ab |
| 14 | acris | AP15390PU-N | XPO2 / Exportin-2 (N-term); antibody Ab |
| 15 | scbt | CSE1L | CSE1L Antibody / CSE1L Antibodies; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0005643 | Component | nuclear pore |
| GO:0005634 | Component | nucleus |
| GO:0008262 | Function | importin-alpha export receptor activity |
| GO:0005515 | Function | protein binding |
| GO:0006915 | Process | apoptosis |
| GO:0008283 | Process | cell proliferation |
| GO:0006886 | Process | intracellular protein transport |
| GO:0000059 | Process | protein import into nucleus, docking |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000262982 | MI0000434 | hsa-let-7i* | CUGCGCAAGCUACUGCCUUGCU |
| ENST00000262982 | MI0000442 | hsa-miR-122* | AACGCCAUUAUCACACUAAAUA |
| ENST00000262982 | MI0000470 | hsa-miR-125b-2* | UCACAAGUCAGGCUCUUGGGAC |
| ENST00000262982 | MI0000454 | hsa-miR-137 | UUAUUGCUUAAGAAUACGCGUAG |
| ENST00000262982 | MI0000261 | hsa-miR-139-5p | UCUACAGUGCACGUGUCUCCAG |
| ENST00000262982 | MI0000480 | hsa-miR-154 | UAGGUUAUCCGUGUUGCCUUCG |
| ENST00000262982 | MI0000480 | hsa-miR-154* | AAUCAUACACGGUUGACCUAUU |
| ENST00000262982 | MI0000069 | hsa-miR-15a | UAGCAGCACAUAAUGGUUUGUG |
| ENST00000262982 | MI0000438 | hsa-miR-15b | UAGCAGCACAUCAUGGUUUACA |
| ENST00000262982 | MI0000272 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACACU |
| ENST00000262982 | MI0000488 | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
| ENST00000262982 | MI0000732 | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
| ENST00000262982 | MI0000073 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| ENST00000262982 | MI0000074 | hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA |
| ENST00000262982 | MI0000075 | hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA |
| ENST00000262982 | MI0000283 | hsa-miR-203 | GUGAAAUGUUUAGGACCACUAG |
| ENST00000262982 | MI0000077 | hsa-miR-21 | UAGCUUAUCAGACUGAUGUUGA |
| ENST00000262982 | MI0000296 | hsa-miR-219-5p | UGAUUGUCCAAACGCAAUUCU |
| ENST00000262982 | MI0000740 | hsa-miR-219-5p | UGAUUGUCCAAACGCAAUUCU |
| ENST00000262982 | MI0000079 | hsa-miR-23a | AUCACAUUGCCAGGGAUUUCC |
| ENST00000262982 | MI0000439 | hsa-miR-23b | AUCACAUUGCCAGGGAUUACC |
| ENST00000262982 | MI0000083 | hsa-miR-26a | UUCAAGUAAUCCAGGAUAGGCU |
| ENST00000262982 | MI0000750 | hsa-miR-26a | UUCAAGUAAUCCAGGAUAGGCU |
| ENST00000262982 | MI0000087 | hsa-miR-29a | UAGCACCAUCUGAAAUCGGUUA |
| ENST00000262982 | MI0000087 | hsa-miR-29a* | ACUGAUUUCUUUUGGUGUUCAG |
| ENST00000262982 | MI0000735 | hsa-miR-29c | UAGCACCAUUUGAAAUCGGUUA |
| ENST00000262982 | MI0000806 | hsa-miR-337-5p | GAACGGCUUCAUACAGGAGUU |
| ENST00000262982 | MI0003646 | hsa-miR-33b | GUGCAUUGCUGUUGCAUUGC |
| ENST00000262982 | MI0000779 | hsa-miR-371-5p | ACUCAAACUGUGGGGGCACU |
| ENST00000262982 | MI0000785 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
| ENST00000262982 | MI0001145 | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
| ENST00000262982 | MI0001446 | hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA |
| ENST00000262982 | MI0002471 | hsa-miR-487a | AAUCAUACAGGGACAUCCAGUU |
| ENST00000262982 | MI0003185 | hsa-miR-501-5p | AAUCCUUUGUCCCUGGGUGAGA |
| ENST00000262982 | MI0003190 | hsa-miR-505 | CGUCAACACUUGCUGGUUUCCU |
| ENST00000262982 | MI0003161 | hsa-miR-517a | AUCGUGCAUCCCUUUAGAGUGU |
| ENST00000262982 | MI0003174 | hsa-miR-517c | AUCGUGCAUCCUUUUAGAGUGU |
| ENST00000262982 | MI0005539 | hsa-miR-541* | AAAGGAUUCUGCUGUCGGUCCCACU |
| ENST00000262982 | MI0003686 | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
| ENST00000262982 | MI0003567 | hsa-miR-561 | CAAAGUUUAAGAUCCUUGAAGU |
| ENST00000262982 | MI0003581 | hsa-miR-574-3p | CACGCUCAUGCACACACCCACA |
| ENST00000262982 | MI0003602 | hsa-miR-590-5p | GAGCUUAUUCAUAAAAGUGCAG |
| ENST00000262982 | MI0003607 | hsa-miR-595 | GAAGUGUGCCGUGGUGUGUCU |
| ENST00000262982 | MI0003626 | hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC |
| ENST00000262982 | MI0003637 | hsa-miR-623 | AUCCCUUGCAGGGGCUGUUGGGU |
| ENST00000262982 | MI0003642 | hsa-miR-628-3p | UCUAGUAAGAGUGGCAGUCGA |
| ENST00000262982 | MI0003643 | hsa-miR-629 | UGGGUUUACGUUGGGAGAACU |
| ENST00000262982 | MI0003663 | hsa-miR-648 | AAGUGUGCAGGGCACUGGU |
| ENST00000262982 | MI0003666 | hsa-miR-651 | UUUAGGAUAAGCUUGACUUUUG |
| ENST00000262982 | MI0003757 | hsa-miR-758 | UUUGUGACCUGGUCCACUAACC |
| ENST00000262982 | MI0003763 | hsa-miR-767-3p | UCUGCUCAUACCCCAUGGUUUCU |
| ENST00000262982 | MI0003906 | hsa-miR-802 | CAGUAACAAAGAUUCAUCCUUGU |
| ENST00000262982 | MI0005542 | hsa-miR-876-5p | UGGAUUUCUUUGUGAAUCACCA |
| ENST00000262982 | MI0005540 | hsa-miR-889 | UUAAUAUCGGACAACCAUUGU |
| ENST00000262982 | MI0000746 | hsa-miR-99b | CACCCGUAGAACCGACCUUGCG |
| ENST00000262982 | MI0000590 | mmu-miR-322 | CAGCAGCAAUUCAUGUUUUGGA |
| ENST00000262982 | MI0002398 | mmu-miR-463 | UGAUAGACACCAUAUAAGGUAG |
| ENST00000262982 | MI0005510 | mmu-miR-466g | AUACAGACACAUGCACACACA |
| ENST00000262982 | MI0005511 | mmu-miR-466h | UGUGUGCAUGUGCUUGUGUGUA |
| ENST00000262982 | MI0004673 | mmu-miR-669c | AUAGUUGUGUGUGGAUGUGUGU |
| ENST00000262982 | MI0004638 | mmu-miR-679 | GGACUGUGAGGUGACUCUUGGU |
| ENST00000262982 | MI0004685 | mmu-miR-701 | UUAGCCGCUGAAAUAGAUGGA |
| ENST00000262982 | MI0004700 | mmu-miR-715 | CUCCGUGCACACCCCCGCGUG |
| ENST00000262982 | MI0004310 | mmu-miR-764-5p | GGUGCUCACAUGUCCUCCU |
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| Ethinyl Estradiol | |
|
|
| kojic acid | |
|
|
| Tamoxifen | |
|
|
| Thiophenes | |
|
|
| Tretinoin | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Gene Interactions
[
] BioGRID Gene Product Interaction Database
| Symbol | Interaction Binary | Experiment | Source |
|---|---|---|---|
| CDH1 | CDH1 / CSE1L | Affinity Capture-Western | Jiang MC (2002) |
| FLJ23375 | CSE1L / FLJ23375 | Two-hybrid | Stelzl U (2005) |
| HNRPL | CSE1L / HNRPL | Two-hybrid | Stelzl U (2005) |
| KPNA1 | CSE1L / KPNA1 | Reconstituted Complex | Kohler M (1999) |
| kpna2 | CSE1L / kpna2 | Reconstituted Complex | Kutay U (1997) |
| KPNA2 | CSE1L / KPNA2 | Reconstituted Complex | Kohler M (1999) |
| KPNA2 | KPNA2 / CSE1L | Reconstituted Complex | Kutay U (1997) |
| KPNA4 | CSE1L / KPNA4 | Reconstituted Complex | Kohler M (1999) |
| PPP5C | PPP5C / CSE1L | Two-hybrid | Stelzl U (2005) |
| RPL22 | RPL22 / CSE1L | Two-hybrid | Stelzl U (2005) |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Liao CF, et al. (2008) "CSE1L/CAS, a microtubule-associated protein, inhibits taxol (paclitaxel)-induced apoptosis but enhances cancer cell apoptosis induced by various chemotherapeutic drugs." BMB Rep. 41(3):210-216. PMID:18377724 - [
] Kodiha M, et al. (2008) "Dissection of the molecular mechanisms that control the nuclear accumulation of transport factors importin-alpha and CAS in stressed cells." Cell Mol Life Sci. 65(11):1756-1767. PMID:18425415 - [
] Kim HE, et al. (2008) "PHAPI, CAS, and Hsp70 promote apoptosome formation by preventing Apaf-1 aggregation and enhancing nucleotide exchange on Apaf-1." Mol Cell. 30(2):239-247. PMID:18439902 - [
] Tanaka T, et al. (2007) "hCAS/CSE1L associates with chromatin and regulates expression of select p53 target genes." Cell. 130(4):638-650. PMID:17719542 - [
] Shiraki K, et al. (2006) "Cellular apoptosis susceptibility protein and proliferation in human hepatocellular carcinoma." Int J Mol Med. 18(1):77-81. PMID:16786158 - [
] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070 - [
] Anderson NL, et al. (2004) "The human plasma proteome: a nonredundant list developed by combination of four separate sources." Mol Cell Proteomics. 3(4):311-326. PMID:14718574 - [
] Bouwmeester T, et al. (2004) "A physical and functional map of the human TNF-alpha/NF-kappa B signal transduction pathway." Nat Cell Biol. 6(2):97-105. PMID:14743216 - [
] Jin J, et al. (2004) "Proteomic, functional, and domain-based analysis of in vivo 14-3-3 binding proteins involved in cytoskeletal regulation and cellular organization." Curr Biol. 14(16):1436-1450. PMID:15324660 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Behrens P, et al. (2003) "CSE1L/CAS: its role in proliferation and apoptosis." Apoptosis. 8(1):39-44. PMID:12510150 - [
] Goldberg GS, et al. (2003) "Src phosphorylates Cas on tyrosine 253 to promote migration of transformed cells." J Biol Chem. 278(47):46533-46540. PMID:12972425 - [
] McBride KM, et al. (2002) "Regulated nuclear import of the STAT1 transcription factor by direct binding of importin-alpha." EMBO J. 21(7):1754-1763. PMID:11927559 - [
] Jiang MC, et al. (2002) "CAS/CSE 1 stimulates E-cadhrin-dependent cell polarity in HT-29 human colon epithelial cells." Biochem Biophys Res Commun. 294(4):900-905. PMID:12061792 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Wellmann A, et al. (2001) "High expression of the proliferation and apoptosis associated CSE1L/CAS gene in hepatitis and liver neoplasms: correlation with tumor progression." Int J Mol Med. 7(5):489-494. PMID:11295109 - [
] Jiang MC, et al. (2001) "IRF-1-mediated CAS expression enhances interferon-gamma-induced apoptosis of HT-29 colon adenocarcinoma cells." Mol Cell Biol Res Commun. 4(6):353-358. PMID:11703094 - [
] Behrens P, et al. (2001) "Implication of the proliferation and apoptosis associated CSE1L/CAS gene for breast cancer development." Anticancer Res. 21(4A):2413-2417. PMID:11724300 - [
] Deloukas P, et al. (2001) "The DNA sequence and comparative analysis of human chromosome 20." Nature. 414(6866):865-871. PMID:11780052 - [
] Brinkmann U, et al. (1999) "Tissue-specific alternative splicing of the CSE1L/CAS (cellular apoptosis susceptibility) gene." Genomics. 58(1):41-49. PMID:10331944 - [
] Kohler M, et al. (1999) "Evidence for distinct substrate specificities of importin alpha family members in nuclear protein import." Mol Cell Biol. 19(11):7782-7791. PMID:10523667 - [
] Herold A, et al. (1998) "Determination of the functional domain organization of the importin alpha nuclear import factor." J Cell Biol. 143(2):309-318. PMID:9786944 - [
] Kutay U, et al. (1997) "Export of importin alpha from the nucleus is mediated by a specific nuclear transport factor." Cell. 90(6):1061-1071. PMID:9323134 - [
] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149 - [
] Brinkmann U, et al. (1996) "Role of CAS, a human homologue to the yeast chromosome segregation gene CSE1, in toxin and tumor necrosis factor mediated apoptosis." Biochemistry. 35(21):6891-6899. PMID:8639641 - [
] Brinkmann U, et al. (1996) "The human CAS (cellular apoptosis susceptibility) gene mapping on chromosome 20q13 is amplified in BT474 breast cancer cells and part of aberrant chromosomes in breast and colon cancer cell lines." Genome Res. 6(3):187-194. PMID:8963895 - [
] Brinkmann U, et al. (1995) "Cloning and characterization of a cellular apoptosis susceptibility gene, the human homologue to the yeast chromosome segregation gene CSE1." Proc Natl Acad Sci U S A. 92(22):10427-10431. PMID:7479798 - [
] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298
CSE1L/CAS, a microtubule-associated, cellular apoptosis susceptibility protein, is highly expressed in various cancers. Microtubules are the target of paclitaxel-induced apoptosis. We studied the effects of increased or reduced CAS expression on cancer cell apoptosis induced by chemotherapeutic drugs including paclitaxel. Our results showed that CAS overexpression enhanced apoptosis induced by doxorubicin, 5-fluorouracil, cisplatin, and tamoxifen, but inhibited paclitaxel-induced apoptosis of cancer cells. Reductions in CAS produced opposite results. CAS overexpression enhanced p53 accumulation induced by doxorubicin, 5-fluorouracil, cisplatin, tamoxifen, and etoposide. CAS was associated with alpha-tubulin and beta-tubulin and enhanced the association between alpha-tubulin and beta-tubulin. Paclitaxel can induce G2/M phase cell cycle arrest and microtubule aster formation during apoptosis induction, but CAS overexpression reduced paclitaxel-induced G2/M phase cell cycle arrest and microtubule aster formation. Our results indicate that CAS may play an important role in regulating the cytotoxicities of chemotherapeutic drugs used in cancer chemotherapy against cancer cells.
The physiological state of eukaryotic cells controls nuclear trafficking of numerous cargos. For example, stress results in the inhibition of classical protein import, which is characterized by the redistribution of several transport factors. As such, importin-alpha and cellular apoptosis susceptibility protein (CAS) accumulate in nuclei of heat-shocked cells; however, the mechanisms underlying this relocation are not fully understood. We now show that heat upregulates the initial docking of importin-alpha at the nuclear envelope and stimulates the translocation of CAS into the nuclear interior. Moreover, heat exposure compromises the exit of importin-alpha from nuclei and drastically increases its retention in the nucleoplasm, whereas CAS nuclear exit and retention are less affected. Taken together, our results support the idea that heat shock regulates importin-alpha and CAS nuclear accumulation at several levels. The combination of different stress-induced changes leads to the nuclear concentration of both transport factors in heat-stressed cells.
During apoptosis, cytochrome c is released from mitochondria to the cytosol, where it binds Apaf-1. The Apaf-1/cytochrome c complex then oligomerizes either into heptameric caspase-9-activating apoptosome, which subsequently activates caspase-3 and caspase-7, or bigger inactive aggregates, depending on the availability of nucleotide dATP/ATP. A tumor suppressor protein, PHAPI, enhances caspase-9 activation by promoting apoptosome formation through an unknown mechanism. We report here the identification of cellular apoptosis susceptibility protein (CAS) and heat shock protein 70 (Hsp70) as mediators of PHAPI activity. PHAPI, CAS, and Hsp70 function together to accelerate nucleotide exchange on Apaf-1 and prevent inactive Apaf-1/cytochrome c aggregation. CAS expression is induced by multiple apoptotic stimuli including UV irradiation. Knockdown of CAS by RNA interference (RNAi) in cells attenuates apoptosis induced by UV light and causes endogenous Apaf-1 to form aggregates. These studies indicated that PHAPI, CAS, and Hsp70 play an important regulatory role during apoptosis.
The p53 tumor suppressor protein regulates many genes that can determine different cellular outcomes such as growth arrest or cell death. Promoter-selective transactivation by p53, although critical for the different cellular outcomes, is not well understood. We report here that the human cellular apoptosis susceptibility protein (hCAS/CSE1L) associates with a subset of p53 target promoters, including PIG3, in a p53-autonomous manner. Downregulation of hCAS/CSE1L decreases transcription from those p53 target promoters to which it preferentially binds and reduces apoptosis. In addition, hCAS/CSE1L silencing leads to increased methylation of histone H3 lysine 27 within the PIG3 gene. hCAS/CSE1L was previously shown to function as a nucleo-cytoplasmic transport factor, as does its closely related yeast homologue Cse1, which can also associate with chromatin and serve as a barrier protein that prevents spreading of heterochromatin. Thus, human CAS/CSE1L can bind select genes with significant functional consequences for p53-mediated transcription and determine cellular outcome.
The cellular apoptosis susceptibility protein (CAS) is the human homologue of the product of the essential yeast chromosome segregation gene, CSE1, and has important roles in tumor necrosis factor (TNF)-induced apoptosis and cell proliferation. In this study, we used immunoblotting and immunohistochemistry to look at CAS expression in human hepatocellular carcinoma (HCC) cells. We also studied the correlation between CAS expression and cell proliferation. To do this, we studied the expression of proliferating cell nuclear antigen (PCNA) by immunostaining and at apoptosis by in situ nick end-labeling (TUNEL), followed by calculation of the PCNA labeling index (PCNA LI) and TUNEL labeling index (TUNEL LI). CAS was constitutively expressed in human HCC cell lines and was primarily confined to the cytoplasm of the cells. PCNA LI and TUNEL LI were significantly higher in HCC than in non-tumor tissue (p<0.01); however, the ratio of TUNEL LI/PCNA LI in HCC was significantly lower than that of non-tumor tissue. Immunohistochemistry revealed that the staining intensity score of CAS in HCC was significantly higher than that of non-tumor tissue (p<0.05). These results indicate that there is an augmentation of pro-liferative activity and apoptosis in HCC tissue, as compared to non-tumor tissue. There was a significant positive correlation between CAS and PCNA LI (p<0.05). In addition, we observed an inverse relationship between CAS expression and TUNEL LI, although the correlation did not reach statistical significance. These results suggest that CAS is expressed at higher levels in human HCC tissue than in non-tumor tissue. CAS may be associated with cell proliferation rather than apoptosis, and further, CAS might play an important role in the development of human HCCs.
Protein-protein interaction maps provide a valuable framework for a better understanding of the functional organization of the proteome. To detect interacting pairs of human proteins systematically, a protein matrix of 4456 baits and 5632 preys was screened by automated yeast two-hybrid (Y2H) interaction mating. We identified 3186 mostly novel interactions among 1705 proteins, resulting in a large, highly connected network. Independent pull-down and co-immunoprecipitation assays validated the overall quality of the Y2H interactions. Using topological and GO criteria, a scoring system was developed to define 911 high-confidence interactions among 401 proteins. Furthermore, the network was searched for interactions linking uncharacterized gene products and human disease proteins to regulatory cellular pathways. Two novel Axin-1 interactions were validated experimentally, characterizing ANP32A and CRMP1 as modulators of Wnt signaling. Systematic human protein interaction screens can lead to a more comprehensive understanding of protein function and cellular processes.
We have merged four different views of the human plasma proteome, based on different methodologies, into a single nonredundant list of 1175 distinct gene products. The methodologies used were 1) literature search for proteins reported to occur in plasma or serum; 2) multidimensional chromatography of proteins followed by two-dimensional electrophoresis and mass spectroscopy (MS) identification of resolved proteins; 3) tryptic digestion and multidimensional chromatography of peptides followed by MS identification; and 4) tryptic digestion and multidimensional chromatography of peptides from low-molecular-mass plasma components followed by MS identification. Of 1,175 nonredundant gene products, 195 were included in more than one of the four input datasets. Only 46 appeared in all four. Predictions of signal sequence and transmembrane domain occurrence, as well as Genome Ontology annotation assignments, allowed characterization of the nonredundant list and comparison of the data sources. The "nonproteomic" literature (468 input proteins) is strongly biased toward signal sequence-containing extracellular proteins, while the three proteomics methods showed a much higher representation of cellular proteins, including nuclear, cytoplasmic, and kinesin complex proteins. Cytokines and protein hormones were almost completely absent from the proteomics data (presumably due to low abundance), while categories like DNA-binding proteins were almost entirely absent from the literature data (perhaps unexpected and therefore not sought). Most major categories of proteins in the human proteome are represented in plasma, with the distribution at successively deeper layers shifting from mostly extracellular to a distribution more like the whole (primarily cellular) proteome. The resulting nonredundant list confirms the presence of a number of interesting candidate marker proteins in plasma and serum.
Signal transduction pathways are modular composites of functionally interdependent sets of proteins that act in a coordinated fashion to transform environmental information into a phenotypic response. The pro-inflammatory cytokine tumour necrosis factor (TNF)-alpha triggers a signalling cascade, converging on the activation of the transcription factor NF-kappa B, which forms the basis for numerous physiological and pathological processes. Here we report the mapping of a protein interaction network around 32 known and candidate TNF-alpha/NF-kappa B pathway components by using an integrated approach comprising tandem affinity purification, liquid-chromatography tandem mass spectrometry, network analysis and directed functional perturbation studies using RNA interference. We identified 221 molecular associations and 80 previously unknown interactors, including 10 new functional modulators of the pathway. This systems approach provides significant insight into the logic of the TNF-alpha/NF-kappa B pathway and is generally applicable to other pathways relevant to human disease.
BACKGROUND: 14-3-3 proteins are abundant and conserved polypeptides that mediate the cellular effects of basophilic protein kinases through their ability to bind specific peptide motifs phosphorylated on serine or threonine. RESULTS: We have used mass spectrometry to analyze proteins that associate with 14-3-3 isoforms in HEK293 cells. This identified 170 unique 14-3-3-associated proteins, which show only modest overlap with previous 14-3-3 binding partners isolated by affinity chromatography. To explore this large set of proteins, we developed a domain-based hierarchical clustering technique that distinguishes structurally and functionally related subsets of 14-3-3 target proteins. This analysis revealed a large group of 14-3-3 binding partners that regulate cytoskeletal architecture. Inhibition of 14-3-3 phosphoprotein recognition in vivo indicates the general importance of such interactions in cellular morphology and membrane dynamics. Using tandem proteomic and biochemical approaches, we identify a phospho-dependent 14-3-3 binding site on the A kinase anchoring protein (AKAP)-Lbc, a guanine nucleotide exchange factor (GEF) for the Rho GTPase. 14-3-3 binding to AKAP-Lbc, induced by PKA, suppresses Rho activation in vivo. CONCLUSION: 14-3-3 proteins can potentially engage around 0.6% of the human proteome. Domain-based clustering has identified specific subsets of 14-3-3 targets, including numerous proteins involved in the dynamic control of cell architecture. This notion has been validated by the broad inhibition of 14-3-3 phosphorylation-dependent binding in vivo and by the specific analysis of AKAP-Lbc, a RhoGEF that is controlled by its interaction with 14-3-3.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
CAS/CSE1L is the human homologue of the yeast gene CSE1. It was first cloned while searching for genes that rendered breast cancer cells resistant towards toxin induced apoptosis. Since depletion of CSE1 leads to cell-cycle arrest, CAS is thought to be involved in proliferation. CAS functions in the mitotic spindle checkpoint. CAS is located on chromosome 20q13, a locus often amplified in cancers of various origin, e.g. colonic or breast cancer. Since genetic instability is a hallmark of cancer, amplification or over expression of the CAS gene might interfere with or override its role in the mitotic spindle checkpoint. CAS is also implicated in the nuclear to cytoplasmic reshuffling of importin alpha, which itself is necessary for the nuclear transport of several proliferation activating proteins, transcription factors, oncogene and tumor suppressor gene products such as p53 and BRCA1. Inhibition of MEK1 mediated phosphorylation has been shown to enhance paclitaxel (Taxol) induced apoptosis in breast, ovarian, and lung tumor cell lines in-vitro. Since CAS is also phosphorylated (activated) by MEK1, and since the anti-cancer drug Taxol alters the microtubule assembly and activates pro-apoptotic signaling pathways, altering the activity/phosphorylation status of CAS via MEK1 inhibition may present a potential strategy in experimental cancer therapy.
Cas is a member of the focal adhesion complex. Phosphorylation of Cas by Src is an important event leading to cell transformation. Using mass spectrometry, we have mapped 11 sites in Cas that are phosphorylated by Src. These sites are all located between residues 132 and 414 of Cas, in a region that is required for binding to a number of other proteins including Crk. We tested synthetic peptides modeled on Cas phosphorylation sites, and found that the sequence containing tyrosine 253 was phosphorylated by Src most efficiently. Using cells derived from Cas-deficient mice, we confirmed that Cas greatly enhanced the ability of Src to transform cells. Phosphorylation of Cas on tyrosine 253 was not required for Src to increase growth rate, suppress contact inhibition, or suppress anchorage dependence. Yet, in contrast to these growth characteristics, phosphorylation of Cas on tyrosine 253 was required for Src to promote cell migration. Thus, a single phosphorylation site on this focal adhesion adaptor protein can effectively separate cell migration from other transformed growth characteristics.
Signal transducers and activators of transcription (STATs) reside in a latent state in the cytoplasm of the cell, but accumulate in the nucleus in response to cytokines or growth factors. Localization in the nucleus occurs following STAT tyrosine phosphorylation and dimerization. In this report we demonstrate a direct interaction of importin-alpha5 with tyrosine-phosphorylated STAT1 dimers, and provide evidence that a nuclear localization signal (NLS) exists in an inactive state within a STAT1 monomer. A mutation in STAT1 leucine 407 (L407A) is characterized, which generates a protein that is accurately tyrosine phosphorylated in response to interferon, dimerizes and binds DNA, but does not localize to the nucleus. The import defect of STAT1(L407A) appears to be a consequence of the inability of this protein to be recognized by its import shuttling receptor. In addition, we demonstrate that STAT1 binding to specific target DNA effectively blocks importin-alpha5 binding. This result may play a role in localizing STAT1 to its destination in the nucleus, and in releasing importin-alpha5 from STAT1 for recycling back to the cytoplasm.
The establishment and maintenance of epithelial polarity are crucial for tissue organization and function in mammals. Epithelial cadherin (E-cadherin) is expressed in epithelial cell membrane and is important for cell-cell adhesion, intercellular junctions formation, as well as epithelial cell polarization. We report herein that CAS (CAS/CSE 1), the human cellular apoptosis susceptibility protein, interacts with E-cadherin and stimulates polarization of HT-29 human colon epithelial cells. CAS binds with E-cadherin but not with beta-catenin in the immunoprecipitation assays. Interaction of CAS with E-cadherin enhances the formation of E-cadherin/beta-catenin cell-cell adhesive complex. Electron microscopic study demonstrated that CAS overexpression in cells stimulates intercellular junction complex formation. The disorganization of cellular cytoskeleton by cytochalasin D, colchicine, or acrylamide treatment disrupts CAS-stimulated HT-29 cell polarization. CAS-mediated HT-29 cell polarity is also inhibited by antisense E-cadherin DNA expression. Our results indicate that CAS cooperates with E-cadherin and plays a role in the establishment of epithelial cell polarity.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
The CSE1L/CAS protein (CAS) is a Ran-binding protein with a function as nuclear transport (export) factor. Like recently observed for ran and other ran-binding proteins, CSE1L/CAS simultaneously plays a role in the mitotic spindle checkpoint, which assures genomic stability during cell division. This checkpoint is frequently disturbed in neoplasias of various origin, including hepatic tumors. We have evaluated by immunohistology the expression of CAS in adult and embryonic liver, hepatitis, and in liver hyperplasias. Normal hepatocytes revealed no CAS expression while embryonic liver showed strong expression in all parenchymal cells. Bile ducts stained positive with anti-CAS antibodies, and strong CAS expression was also detected at the interface between bile ducts and hepatocytes under conditions associated with regenerative proliferation. The localization of these CAS expressing cells correlated with the distribution of putative liver stem-cells. In active viral (but not in inactive) hepatitis, strong hepatocytal CAS expression correlates in site and intensity with degree of inflammation. Neoplastic liver demonstrated different degrees of CAS expression: no remarkable expression in adenomas, moderate expression in a narrow rim of hepatocytes and in periseptal cholangiolar proliferations in focal nodular hyperplasia, and strong CAS expression in hepatocellular carcinoma. Less differentiated tumors stain stronger than well differentiated. Cholangio-cellular carcinomas show even stronger CAS expression than hepatocellular carcinomas. Our observation of strong expression of CAS in liver cells that are committed for proliferation among them possibly liver stem cells, and in liver neoplasms, is consistant with the fact that CAS functions not solely as a nuclear transport factor but that it is also essential for cell proliferation, particularly for the mitotic spindle checkpoint. Interestingly, genomic instability is frequently observed in hepatic tumors which we have shown here to express large amounts of CAS. Since the degree of CAS-expression correlates with the grade of tumor dedifferentiation, we suggest that CAS should also be further investigated as prognostic marker for hepatic neoplasms.
The expression of CAS is reported to be upregulated in a variety of human tumor cells, and such expression correlates with the development of tumors. CAS also plays a role in apoptosis. We investigated whether CAS expression affects the susceptibility of tumor cells to IFN-gamma-induced apoptosis. Our data show that IFN-gamma treatment induces CAS expression in HT-29 tumor cells. IFN-gamma-induced gene expression is primarily mediated by the transcriptional factor, IRF-1. Our data show that IRF-1 mediates IFN-gamma-induced CAS expression. Transfection of HT-29 cells with CAS expression vector did not induce apoptosis of cells; nevertheless, CAS overexpression greatly enhanced IFN-gamma-induced apoptosis of cells. CPP32 is regarded as one of the central apoptosis executioner molecules. CAS overexpression enhances IFN-gamma-induced CPP32 expression. These results indicate that tumor cells highly expressing CAS may be more susceptible to apoptosis induced by reagents that are capable of inducing CAS expression. Thus, CAS may be a target for the elimination of tumors.
The CSEIL/CAS protein (CAS) is a Ran-binding protein with a function as a nuclear transport (export) factor. CSEIL/CAS, similar to Ran and other ran-binding proteins, plays at the same time an important role in the mitotic spindle checkpoint, which assures genomic stability during cell division. This checkpoint is frequently disturbed in neoplasms of various origin, including breast, hepatic and colonic tumors. CAS is located on chromosome 20ql3 and amplified in several cell lines, including breast, colon and bladder cancer. MEKl phosphorylation is known to be a reason for different CAS localization and activity. We evaluated the expression of CAS in 50 benign and malignant tumors of the breast by immunohistochemistry. Benign lesions of the breast (n=13) revealed a weak, predominantly cytoplasmatic CAS positivity. In ductal and lobular in situ carcinomas (n=17), 70-90% of the tumor cells were positive for anti-CAS staining which was predominantly cytoplasmatic. In invasive ductal and lobular carcinomas (n =20), 70-90% of the tumor cells stained positive with anti-CAS in a predominantly nuclear pattern. Different localization of CAS might affect its role not only for chromosome segregation, proliferation and apoptosis, but also its function in nuclear transport of proteins like retinoblastoma-gene-product, p53 and BRCAl. A different regulation in this checkpoint might contribute to the invasive potential in malignant carcinomas of the breast. Alteration of CAS-activity, possibly via MEKl-inhibition, might therefore be a possible option for breast cancer therapy.
The finished sequence of human chromosome 20 comprises 59,187,298 base pairs (bp) and represents 99.4% of the euchromatic DNA. A single contig of 26 megabases (Mb) spans the entire short arm, and five contigs separated by gaps totalling 320 kb span the long arm of this metacentric chromosome. An additional 234,339 bp of sequence has been determined within the pericentromeric region of the long arm. We annotated 727 genes and 168 pseudogenes in the sequence. About 64% of these genes have a 5' and a 3' untranslated region and a complete open reading frame. Comparative analysis of the sequence of chromosome 20 to whole-genome shotgun-sequence data of two other vertebrates, the mouse Mus musculus and the puffer fish Tetraodon nigroviridis, provides an independent measure of the efficiency of gene annotation, and indicates that this analysis may account for more than 95% of all coding exons and almost all genes.
CSE1L/CAS (CAS) is a nuclear transport factor that plays a role in proliferation and apoptosis. The CAS gene consists of 25 exons. mRNA homologous over its entire length to the yeast homologue CSE1 is the predominant transcript in proliferating tissues. Additional mRNAs are generated by alternative splicing in a tissue-specific manner. An extended 3'-end is found in fetal and adult brain. A mRNA containing the 5'-end of CAS up to position 690 and an alternative 3'-end is expressed in trachea and encodes a truncated Ran-binding domain. Fetal liver expresses a mRNA with deletions of a central portion of CAS and additional sequences encoded by the last intron. SW480 colon cancer cells express another approximately 1500-base mRNA. Western blot analyses of various human tissues and immunohistology of mouse embryos show a correlation of CAS transcripts and CAS protein in different tissues. CAS isoforms may control nuclear transport of tissue-specific proteins.
Importin alpha plays a pivotal role in the classical nuclear protein import pathway. Importin alpha shuttles between nucleus and cytoplasm, binds nuclear localization signal-bearing proteins, and functions as an adapter to access the importin beta-dependent import pathway. In contrast to what is found for importin beta, several isoforms of importin alpha, which can be grouped into three subfamilies, exist in higher eucaryotes. We describe here a novel member of the human family, importin alpha7. To analyze specific functions of the distinct importin alpha proteins, we recombinantly expressed and purified five human importin alpha's along with importin alpha from Xenopus and Saccharomyces cerevisiae. Binding affinity studies showed that all importin alpha proteins from humans or Xenopus bind their import receptor (importin beta) and their export receptor (CAS) with only marginal differences. Using an in vitro import assay based on permeabilized HeLa cells, we compared the import substrate specificities of the various importin alpha proteins. When the substrates were tested singly, only the import of RCC1 showed a strong preference for one family member, importin alpha3, whereas most of the other substrates were imported by all importin alpha proteins with similar efficiencies. However, strikingly different substrate preferences of the various importin alpha proteins were revealed when two substrates were offered simultaneously.
Although importin alpha (Imp alpha) has been shown to act as the receptor for basic nuclear localization signals (NLSs) and to mediate their recruitment to the importin beta nuclear import factor, little is known about the functional domains present in Imp alpha, with the exception that importin beta binding is known to map close to the Imp alpha NH2 terminus. Here, we demonstrate that sequences essential for binding to the CAS nuclear export factor are located near the Imp alpha COOH terminus and include a critical acidic motif. Although point mutations introduced into this acidic motif inactivated both CAS binding and Imp alpha nuclear export, a putative leucine-rich nuclear export signal proved to be neither necessary nor sufficient for Imp alpha nuclear export. Analysis of sequences within Imp alpha that bind to the SV-40 T antigen NLS or to the similar LEF-1 NLS revealed that both NLSs interact with a subset of the eight degenerate armadillo (Arm) repeats that form the central part of Imp alpha. However, these two NLS-binding sites showed only minimal overlap, thus suggesting that the degeneracy of the Arm repeat region of Imp alpha may serve to facilitate binding to similar but nonidentical basic NLSs. Importantly, the SV-40 T NLS proved able to specifically inhibit the interaction of Imp alpha with CAS in vitro, thus explaining why the SV-40 T NLS is unable to also function as a nuclear export signal.
NLS proteins are transported into the nucleus by the importin alpha/beta heterodimer. Importin alpha binds the NLS, while importin beta mediates translocation through the nuclear pore complex. After translocation, RanGTP, whose predicted concentration is high in the nucleus and low in the cytoplasm, binds importin beta and displaces importin alpha. Importin alpha must then be returned to the cytoplasm, leaving the NLS protein behind. Here, we report that the previously identified CAS protein mediates importin alpha re-export. CAS binds strongly to importin alpha only in the presence of RanGTP, forming an importin alpha/CAS/RanGTP complex. Importin alpha is released from this complex in the cytoplasm by the combined action of RanBP1 and RanGAP1. CAS binds preferentially to NLS-free importin alpha, explaining why import substrates stay in the nucleus.
Using 'oligo-capped' mRNA [Maruyama, K., Sugano, S., 1994. Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene 138, 171-174], whose cap structure was replaced by a synthetic oligonucleotide, we constructed two types of cDNA library. One is a 'full length-enriched cDNA library' which has a high content of full-length cDNA clones and the other is a '5'-end-enriched cDNA library', which has a high content of cDNA clones with their mRNA start sites. The 5'-end-enriched library was constructed especially for isolating the mRNA start sites of long mRNAs. In order to characterize these libraries, we performed one-pass sequencing of randomly selected cDNA clones from both libraries (84 clones for the full length-enriched cDNA library and 159 clones for the 5'-end-enriched cDNA library). The cDNA clones of the polypeptide chain elongation factor 1 alpha were most frequently (nine clones) isolated, and more than 80% of them (eight clones) contained the mRNA start site of the gene. Furthermore, about 80% of the cDNA clones of both libraries whose sequence matched with known genes had the known 5' ends or sequences upstream of the known 5' ends (28 out of 35 for the full length-enriched library and 51 out of 62 for the 5'-end-enriched library). The longest full-length clone of the full length-enriched cDNA library was about 3300 bp (among 28 clones). In contrast, seven clones (out of the 51 clones with the mRNA start sites) from the 5'-end-enriched cDNA library came from mRNAs whose length is more than 3500 bp. These cDNA libraries may be useful for generating 5' ESTs with the information of the mRNA start sites that are now scarce in the EST database.
We have previously isolated by expression/selection cloning plasmids containing human cDNAs that rendered MCF-7 breast cancer cells resistant to immunotoxins, Pseudomonas exotoxin (PE), and diphtheria toxin (DT) [Brinkmann et al. (1995) Mol. Med. 1, 206-216]. Here we describe that one of these resistant plasmids, which contains an antisense cDNA fragment homologous to the yeast chromosome segregation gene CSE1 [CAS; Brinkmann et al. (1995) Proc. Natl. Acad. Sci. U.S.A. 92, 10427-10431], reduces the intracellular content of the human CSE1 homologue CAS protein. CAS reduction confers resistance not only to the ADP-ribosylating toxins PE and DT, but also to tumor necrosis factor alpha and beta. The resistance was observed as reduced apoptosis. CAS antisense did not affect the cell death induced by staurosporine, cycloheximide, or etoposide. The observation that CAS antisense can interfere with apoptosis mediated by TNF and ADP-ribosylating toxins suggests that CAS may play a role in selected pathways of apoptosis.
The CAS (cellular apoptosis susceptibility) gene is the human homolog of the yeast chromosome segregation gene CSE1. CAS may have a dual function in mammalian cells, one in apoptosis and another in cell proliferation. We have now mapped the CAS gene to chromosome 20q13. This region is known to harbor amplifications that correlate with aggressive breast cancer. Southern hybridizations with a CAS cDNA fragment and fluorescent in situ hybridization (FISH) with a P1 clone containing the CAS gene show elevated copy numbers in one leukemia, three of four colon, and in three of seven breast cancer cell lines. Elevated CAS copy number in CEM leukemia and COLO201 colon cancer cells was attributable to additional copies of chromosome 20. In SW480 and COLO205 colon cancer cells CAS is part of aberrant chromosomes containing large parts of 20q. In breast cancer cells CAS is also part of aberrant 20q chromosomes (MDA-MB-157 and UACC-812) or of additional 20q isochromosome in MDA-MB-134. In MDA-MB361 and BT-474 breast cancer cells CAS is separated from other markers centromeric and telomeric of CAS on 20q. MDA-MB 361 contains one additional copy of CAS, separated from the centromeric 20q control probe. BT-474 cells have up to 12 additional CAS copies that we separated from nearby telomeric and centromeric probes on 20q and that are translocated to abnormal chromosomes.
We recently isolated human cDNA fragments that render MCF-7 breast cancer cells resistant to cell death caused by Pseudomonas exotoxin, Pseudomonas exotoxin-derived immunotoxins, diphtheria toxin, and tumor necrosis factor. We report here that one of these fragments is an antisense fragment of a gene homologous to the essential yeast chromosome segregation gene CSE1. Cloning and analysis of the full-length cDNA of the human CSE1 homologue, which we name CAS for cellular apoptosis susceptibility gene, reveals a protein coding region with similar length (971 amino acids for CAS, 960 amino acids for CSE1) and 59% overall protein homology to the yeast CSE1 protein. The conservation of this gene indicates it has an important function in human cells consistent with the essential role of CSE1 in yeast. CAS is highly expressed in human tumor cell lines and in human testis and fetal liver, tissues that contain actively dividing cells. Furthermore, CAS expression increases when resting human fibroblasts are induced to proliferate and decreases when they are growth-arrested. Thus, CAS appears to play an important role in both toxin and tumor necrosis factor-mediated cell death, as well as in cell proliferation.
We have devised a method to replace the cap structure of a mRNA with an oligoribonucleotide (r-oligo) to label the 5' end of eukaryotic mRNAs. The method consists of removing the cap with tobacco acid pyrophosphatase (TAP) and ligating r-oligos to decapped mRNAs with T4 RNA ligase. This reaction was made cap-specific by removing 5'-phosphates of non-capped RNAs with alkaline phosphatase prior to TAP treatment. Unlike the conventional methods that label the 5' end of cDNAs, this method specifically labels the capped end of the mRNAs with a synthetic r-oligo prior to first-strand cDNA synthesis. The 5' end of the mRNA was identified quite simply by reverse transcription-polymerase chain reaction (RT-PCR).
Resource Links
Contents
- Gene Summary
- Orthologs and Paralogs
- Antibodies
- Exon, Intron and UTRs
- CpG near TSS
- Gene Classification
- RefSeq Isoforms
- MicroRNA and Targets
- Transcript Sequences
- Protein Sequences
- Mutations and SNPs
- Phenotypes
- Chemicals and Drugs
- Gene and Diseases
- Gene Interactions
- Transcript Cluster
- Selected Publications

