CSE1L | GeneID:1434 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 1434 Official Symbol CSE1L
Locus N/A Gene Type protein-coding
Synonyms CAS; CSE1; MGC117283; MGC130036; MGC130037; XPO2
Full Name CSE1 chromosome segregation 1-like (yeast)
Description CSE1 chromosome segregation 1-like (yeast)
Chromosome 20q13
Also Known As CSE1 chromosome segregation 1-like protein; OTTHUMP00000043373; cellular apoptosis susceptibility protein; chromosome segregation 1-like; importin-alpha re-exporter
Summary Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1006

ID Symbol Protein Species
GeneID:1434 CSE1L NP_001307.2 Homo sapiens
GeneID:30707 cse1l NP_958858.1 Danio rerio
GeneID:35016 Cas NP_523588.2 Drosophila melanogaster
GeneID:110750 Cse1l NP_076054.1 Mus musculus
GeneID:362273 Cse1l XP_342582.1 Rattus norvegicus
GeneID:419212 CSE1L XP_417389.2 Gallus gallus
GeneID:458318 CSE1L XP_001166085.1 Pan troglodytes
GeneID:477257 CSE1L XP_853206.1 Canis lupus familiaris
GeneID:518622 CSE1L NP_001014933.1 Bos taurus
GeneID:819263 AT2G46520 NP_182175.1 Arabidopsis thaliana
GeneID:852612 CSE1 NP_011276.1 Saccharomyces cerevisiae
GeneID:1272510 AgaP_AGAP010711 XP_311424.1 Anopheles gambiae
GeneID:2540419 kap109 NP_595530.1 Schizosaccharomyces pombe
GeneID:2677245 MGG_03994 XP_361520.2 Magnaporthe grisea
GeneID:2705451 NCU04104.1 XP_323444.1 Neurospora crassa
GeneID:2896506 KLLA0A00869g XP_451037.1 Kluyveromyces lactis
GeneID:4327779 Os01g0235400 NP_001042522.1 Oryza sativa
GeneID:4622083 AGOS_AFR273W NP_985820.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab70547 Cellular Apoptosis Susceptibility antibody (ab70547); Rabbit polyclonal to Cellular Apoptosis Susceptibility
2 abcam ab54674 Cellular Apoptosis Susceptibility antibody (ab54674); Mouse monoclonal to Cellular Apoptosis Susceptibility
3 abcam ab52232 Cellular Apoptosis Susceptibility antibody (ab52232); Rabbit polyclonal to Cellular Apoptosis Susceptibility
4 abcam ab50844 Cellular Apoptosis Susceptibility antibody [30F12] (ab50844); Mouse monoclonal [30F12] to Cellular Apoptosis Susceptibility
5 abcam ab27518 Cellular Apoptosis Susceptibility antibody (ab27518); Rabbit polyclonal to Cellular Apoptosis Susceptibility
6 abcam ab27519 Cellular Apoptosis Susceptibility antibody, prediluted (ab27519); Rabbit polyclonal to Cellular Apoptosis Susceptibility, prediluted
7 abgent AP1935a CSE1L Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
8 abgent AP1935b CSE1L Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
9 scbt CSE1L CSE1L Antibody / CSE1L Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of CSE1L Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of CSE1L Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005643 Component nuclear pore
GO:0005634 Component nucleus
GO:0008262 Function importin-alpha export receptor activity
GO:0005515 Function protein binding
GO:0006915 Process apoptosis
GO:0008283 Process cell proliferation
GO:0006886 Process intracellular protein transport
GO:0000059 Process protein import into nucleus, docking

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001316  UCSC Browser NP_001307 B2R5T4   P55060  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000262982 MI0000434 hsa-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENST00000262982 MI0000442 hsa-miR-122* AACGCCAUUAUCACACUAAAUA
ENST00000262982 MI0000470 hsa-miR-125b-2* UCACAAGUCAGGCUCUUGGGAC
ENST00000262982 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENST00000262982 MI0000261 hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAG
ENST00000262982 MI0000480 hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENST00000262982 MI0000480 hsa-miR-154* AAUCAUACACGGUUGACCUAUU
ENST00000262982 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000262982 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000262982 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENST00000262982 MI0000488 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000262982 MI0000732 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000262982 MI0000073 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENST00000262982 MI0000074 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000262982 MI0000075 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000262982 MI0000283 hsa-miR-203 GUGAAAUGUUUAGGACCACUAG
ENST00000262982 MI0000077 hsa-miR-21 UAGCUUAUCAGACUGAUGUUGA
ENST00000262982 MI0000296 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENST00000262982 MI0000740 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENST00000262982 MI0000079 hsa-miR-23a AUCACAUUGCCAGGGAUUUCC
ENST00000262982 MI0000439 hsa-miR-23b AUCACAUUGCCAGGGAUUACC
ENST00000262982 MI0000083 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000262982 MI0000750 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000262982 MI0000087 hsa-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENST00000262982 MI0000087 hsa-miR-29a* ACUGAUUUCUUUUGGUGUUCAG
ENST00000262982 MI0000735 hsa-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENST00000262982 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENST00000262982 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000262982 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENST00000262982 MI0000785 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
ENST00000262982 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENST00000262982 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENST00000262982 MI0002471 hsa-miR-487a AAUCAUACAGGGACAUCCAGUU
ENST00000262982 MI0003185 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA
ENST00000262982 MI0003190 hsa-miR-505 CGUCAACACUUGCUGGUUUCCU
ENST00000262982 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENST00000262982 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENST00000262982 MI0005539 hsa-miR-541* AAAGGAUUCUGCUGUCGGUCCCACU
ENST00000262982 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENST00000262982 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENST00000262982 MI0003581 hsa-miR-574-3p CACGCUCAUGCACACACCCACA
ENST00000262982 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENST00000262982 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENST00000262982 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENST00000262982 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENST00000262982 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENST00000262982 MI0003643 hsa-miR-629 UGGGUUUACGUUGGGAGAACU
ENST00000262982 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENST00000262982 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENST00000262982 MI0003757 hsa-miR-758 UUUGUGACCUGGUCCACUAACC
ENST00000262982 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENST00000262982 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENST00000262982 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENST00000262982 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENST00000262982 MI0000746 hsa-miR-99b CACCCGUAGAACCGACCUUGCG
ENST00000262982 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENST00000262982 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENST00000262982 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000262982 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000262982 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENST00000262982 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENST00000262982 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENST00000262982 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG
ENST00000262982 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction Structure
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of CSE1L mRNA
17555576
Ethinyl Estradiol
kojic acid
  • kojic acid results in decreased expression of CSE1L mRNA
16595896
kojic acid
Tamoxifen
  • Tamoxifen affects the expression of CSE1L mRNA
17555576
Tamoxifen
Thiophenes
  • Thiophenes analog promotes the reaction [Tretinoin results in decreased expression of CSE1L mRNA]
16140955
Tretinoin
  • Thiophenes analog promotes the reaction [Tretinoin results in decreased expression of CSE1L mRNA]
  • Tretinoin results in decreased expression of CSE1L mRNA
16140955
Tretinoin

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16935935, 17107899, 17217047, 17339181, 17368321, 16140955, 16331271, 17294898, 17361223, 17301526, 17506722, 16766008, 16788101, 15748426, 12679006, 16823087
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Leukemia, Promyelocytic, Acute inferred via Thiophenes 16140954, 16140955
Breast Neoplasms inferred via Tamoxifen 16202921, 16818667, 16873071, 15668708, 17440819, 17893378, 17261762, 17049068, 15565566, 17242785, 11161223
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 14580682, 16827153
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 15861022, 11677210, 16105132, 17333356, 17681005
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
CDH1 CDH1 / CSE1L Affinity Capture-Western Jiang MC (2002)
FLJ23375 CSE1L / FLJ23375 Two-hybrid Stelzl U (2005)
HNRPL CSE1L / HNRPL Two-hybrid Stelzl U (2005)
KPNA1 CSE1L / KPNA1 Reconstituted Complex Kohler M (1999)
kpna2 CSE1L / kpna2 Reconstituted Complex Kutay U (1997)
KPNA2 CSE1L / KPNA2 Reconstituted Complex Kohler M (1999)
KPNA2 KPNA2 / CSE1L Reconstituted Complex Kutay U (1997)
KPNA4 CSE1L / KPNA4 Reconstituted Complex Kohler M (1999)
PPP5C PPP5C / CSE1L Two-hybrid Stelzl U (2005)
RPL22 RPL22 / CSE1L Two-hybrid Stelzl U (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Liao CF, et al. (2008) "CSE1L/CAS, a microtubule-associated protein, inhibits taxol (paclitaxel)-induced apoptosis but enhances cancer cell apoptosis induced by various chemotherapeutic drugs." BMB Rep. 41(3):210-216. PMID:18377724
  2. [ + ] Kodiha M, et al. (2008) "Dissection of the molecular mechanisms that control the nuclear accumulation of transport factors importin-alpha and CAS in stressed cells." Cell Mol Life Sci. 65(11):1756-1767. PMID:18425415
  3. [ + ] Kim HE, et al. (2008) "PHAPI, CAS, and Hsp70 promote apoptosome formation by preventing Apaf-1 aggregation and enhancing nucleotide exchange on Apaf-1." Mol Cell. 30(2):239-247. PMID:18439902
  4. [ + ] Tanaka T, et al. (2007) "hCAS/CSE1L associates with chromatin and regulates expression of select p53 target genes." Cell. 130(4):638-650. PMID:17719542
  5. [ + ] Shiraki K, et al. (2006) "Cellular apoptosis susceptibility protein and proliferation in human hepatocellular carcinoma." Int J Mol Med. 18(1):77-81. PMID:16786158
  6. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  7. [ + ] Anderson NL, et al. (2004) "The human plasma proteome: a nonredundant list developed by combination of four separate sources." Mol Cell Proteomics. 3(4):311-326. PMID:14718574
  8. [ + ] Bouwmeester T, et al. (2004) "A physical and functional map of the human TNF-alpha/NF-kappa B signal transduction pathway." Nat Cell Biol. 6(2):97-105. PMID:14743216
  9. [ + ] Jin J, et al. (2004) "Proteomic, functional, and domain-based analysis of in vivo 14-3-3 binding proteins involved in cytoskeletal regulation and cellular organization." Curr Biol. 14(16):1436-1450. PMID:15324660
  10. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  11. [ + ] Behrens P, et al. (2003) "CSE1L/CAS: its role in proliferation and apoptosis." Apoptosis. 8(1):39-44. PMID:12510150
  12. [ + ] Goldberg GS, et al. (2003) "Src phosphorylates Cas on tyrosine 253 to promote migration of transformed cells." J Biol Chem. 278(47):46533-46540. PMID:12972425
  13. [ + ] McBride KM, et al. (2002) "Regulated nuclear import of the STAT1 transcription factor by direct binding of importin-alpha." EMBO J. 21(7):1754-1763. PMID:11927559
  14. [ + ] Jiang MC, et al. (2002) "CAS/CSE 1 stimulates E-cadhrin-dependent cell polarity in HT-29 human colon epithelial cells." Biochem Biophys Res Commun. 294(4):900-905. PMID:12061792
  15. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  16. [ + ] Wellmann A, et al. (2001) "High expression of the proliferation and apoptosis associated CSE1L/CAS gene in hepatitis and liver neoplasms: correlation with tumor progression." Int J Mol Med. 7(5):489-494. PMID:11295109
  17. [ + ] Jiang MC, et al. (2001) "IRF-1-mediated CAS expression enhances interferon-gamma-induced apoptosis of HT-29 colon adenocarcinoma cells." Mol Cell Biol Res Commun. 4(6):353-358. PMID:11703094
  18. [ + ] Behrens P, et al. (2001) "Implication of the proliferation and apoptosis associated CSE1L/CAS gene for breast cancer development." Anticancer Res. 21(4A):2413-2417. PMID:11724300
  19. [ + ] Deloukas P, et al. (2001) "The DNA sequence and comparative analysis of human chromosome 20." Nature. 414(6866):865-871. PMID:11780052
  20. [ + ] Brinkmann U, et al. (1999) "Tissue-specific alternative splicing of the CSE1L/CAS (cellular apoptosis susceptibility) gene." Genomics. 58(1):41-49. PMID:10331944
  21. [ + ] Kohler M, et al. (1999) "Evidence for distinct substrate specificities of importin alpha family members in nuclear protein import." Mol Cell Biol. 19(11):7782-7791. PMID:10523667
  22. [ + ] Herold A, et al. (1998) "Determination of the functional domain organization of the importin alpha nuclear import factor." J Cell Biol. 143(2):309-318. PMID:9786944
  23. [ + ] Kutay U, et al. (1997) "Export of importin alpha from the nucleus is mediated by a specific nuclear transport factor." Cell. 90(6):1061-1071. PMID:9323134
  24. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  25. [ + ] Brinkmann U, et al. (1996) "Role of CAS, a human homologue to the yeast chromosome segregation gene CSE1, in toxin and tumor necrosis factor mediated apoptosis." Biochemistry. 35(21):6891-6899. PMID:8639641
  26. [ + ] Brinkmann U, et al. (1996) "The human CAS (cellular apoptosis susceptibility) gene mapping on chromosome 20q13 is amplified in BT474 breast cancer cells and part of aberrant chromosomes in breast and colon cancer cell lines." Genome Res. 6(3):187-194. PMID:8963895
  27. [ + ] Brinkmann U, et al. (1995) "Cloning and characterization of a cellular apoptosis susceptibility gene, the human homologue to the yeast chromosome segregation gene CSE1." Proc Natl Acad Sci U S A. 92(22):10427-10431. PMID:7479798
  28. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298