Abcb6 | GeneID:140669 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 140669 Official Symbol Abcb6
Locus N/A Gene Type protein-coding
Synonyms MGC93242
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 6
Description ATP-binding cassette, sub-family B (MDR/TAP), member 6
Chromosome 9q33
Also Known As
Summary ATP-binding cassette (ABC) half-transporter that together with its dimerization partner alters the localization of toxic substances [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11375

ID Symbol Protein Species
GeneID:10058 ABCB6 NP_005680.1 Homo sapiens
GeneID:41925 CG4225 NP_650503.1 Drosophila melanogaster
GeneID:74104 Abcb6 NP_076221.1 Mus musculus
GeneID:140669 Abcb6 NP_542149.1 Rattus norvegicus
GeneID:176540 hmt-1 NP_001022812.1 Caenorhabditis elegans
GeneID:459959 ABCB6 XP_001161097.1 Pan troglodytes
GeneID:478914 ABCB6 XP_536073.2 Canis lupus familiaris
GeneID:564067 abcb6 XP_692515.3 Danio rerio
GeneID:783257 ABCB6 XP_001251072.1 Bos taurus
GeneID:812037 PF14_0455 XP_001348629.1 Plasmodium falciparum
GeneID:1269280 AgaP_AGAP002278 XP_307900.2 Anopheles gambiae
GeneID:2675723 MGG_05190 XP_359587.2 Magnaporthe grisea
GeneID:2704167 NCU00010.1 XP_322096.1 Neurospora crassa
GeneID:3361134 hmt1 NP_588371.2 Schizosaccharomyces pombe

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab47837 ABCB6 antibody (ab47837); Rabbit polyclonal to ABCB6

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005740 Component mitochondrial envelope
GO:0005741 Component mitochondrial outer membrane
GO:0005739 Component mitochondrion
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_080582  UCSC Browser NP_542149

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000025627 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENSRNOT00000025627 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENSRNOT00000025627 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENSRNOT00000025627 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSRNOT00000025627 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSRNOT00000025627 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSRNOT00000025627 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENSRNOT00000025627 MI0003493 mmu-miR-486 UCCUGUACUGAGCUGCCCCGAG
ENSRNOT00000025627 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENSRNOT00000025627 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENSRNOT00000025627 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU
ENSRNOT00000025627 MI0000832 rno-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENSRNOT00000025627 MI0000896 rno-miR-125b-3p ACGGGUUAGGCUCUUGGGAGCU
ENSRNOT00000025627 MI0000922 rno-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSRNOT00000025627 MI0000923 rno-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENSRNOT00000025627 MI0006134 rno-miR-188 CAUCCCUUGCAUGGUGGAGGG
ENSRNOT00000025627 MI0000946 rno-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSRNOT00000025627 MI0000951 rno-miR-211 UUCCCUUUGUCAUCCUUUGCCU
ENSRNOT00000025627 MI0000863 rno-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENSRNOT00000025627 MI0000862 rno-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENSRNOT00000025627 MI0000864 rno-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENSRNOT00000025627 MI0000865 rno-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSRNOT00000025627 MI0000591 rno-miR-323 CACAUUACACGGUCGACCUCU
ENSRNOT00000025627 MI0000642 rno-miR-351 UCCCUGAGGAGCCCUUUGAGCCUGA
ENSRNOT00000025627 MI0003481 rno-miR-361 UUAUCAGAAUCUCCAGGGGUAC
ENSRNOT00000025627 MI0003553 rno-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENSRNOT00000025627 MI0003552 rno-miR-374 AUAUAAUACAACCUGCUAAGUG
ENSRNOT00000025627 MI0006155 rno-miR-598-3p UACGUCAUCGUCGUCAUCGUUA
ENSRNOT00000025627 MI0006165 rno-miR-770 AGCACCACGUGUCUGGGCCACG
ENSRNOT00000025627 MI0000838 rno-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSRNOT00000025627 MI0000839 rno-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSRNOT00000025627 MI0000840 rno-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSRNOT00000025627 MI0000881 rno-miR-96 UUUGGCACUAGCACAUUUUUGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Jalil YA, et al. (2008) "Vesicular localization of the rat ATP-binding cassette half-transporter rAbcb6." Am J Physiol Cell Physiol. 294(2):C579-C590. PMID:18160489
  2. [ + ] Melaine N, et al. (2006) "Molecular cloning of several rat ABC transporters including a new ABC transporter, Abcb8, and their expression in rat testis." Int J Androl. 29(3):392-399. PMID:16390497
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Mitsuhashi N, et al. (2000) "MTABC3, a novel mitochondrial ATP-binding cassette protein involved in iron homeostasis." J Biol Chem. 275(23):17536-17540. PMID:10837493
  6. [ + ] Hirsch-Ernst KI, et al. (1998) "Molecular cDNA cloning and tissue distribution of mRNA encoding a novel ATP-binding cassette (ABC) half-transporter." Biochem Biophys Res Commun. 249(1):151-155. PMID:9705847
  7. [ + ] Furuya KN, et al. (1997) "Identification of a new P-glycoprotein-like ATP-binding cassette transporter gene that is overexpressed during hepatocarcinogenesis." Cancer Res. 57(17):3708-3716. PMID:9288777