Abcc3 | GeneID:140668 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 140668 Official Symbol Abcc3
Locus N/A Gene Type protein-coding
Synonyms Mlp2; Mrp3
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Chromosome 10q26
Also Known As multidrug resistance protein 3; organic anion transporter
Summary human homolog transports conjugated metabolites from hepatocytes into the bloodstream; may play a role in steroid metabolism [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68364

ID Symbol Protein Species
GeneID:8714 ABCC3 NP_003777.2 Homo sapiens
GeneID:76408 Abcc3 NP_083876.3 Mus musculus
GeneID:140668 Abcc3 NP_542148.1 Rattus norvegicus
GeneID:181202 mrp-4 NP_509658.1 Caenorhabditis elegans
GeneID:422099 ABCC3 XP_420102.2 Gallus gallus
GeneID:491084 ABCC3 XP_548204.2 Canis lupus familiaris
GeneID:533151 ABCC3 XP_612461.3 Bos taurus
GeneID:747938 ABCC3 XP_001158914.1 Pan troglodytes
GeneID:839921 ATMRP13 NP_174330.1 Arabidopsis thaliana
GeneID:839922 ATMRP12 NP_174331.2 Arabidopsis thaliana

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma M0318 Anti-MRP3 antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016323 Component basolateral plasma membrane
GO:0016021 Component integral to membrane
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0015432 Function bile acid-exporting ATPase activity
GO:0015238 Function drug transporter activity
GO:0000166 Function nucleotide binding
GO:0008559 Function xenobiotic-transporting ATPase activity
GO:0015722 Process canalicular bile acid transport
GO:0015893 Process drug transport
GO:0006855 Process multidrug transport
GO:0032355 Process response to estradiol stimulus
GO:0032496 Process response to lipopolysaccharide
GO:0014070 Process response to organic cyclic substance
GO:0010243 Process response to organic nitrogen
GO:0010033 Process response to organic substance

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_080581  UCSC Browser NP_542148

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000003977 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENSRNOT00000003977 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSRNOT00000003977 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSRNOT00000003977 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENSRNOT00000003977 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENSRNOT00000003977 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSRNOT00000003977 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSRNOT00000003977 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSRNOT00000003977 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENSRNOT00000003977 MI0005481 mmu-miR-105 CCAAGUGCUCAGAUGCUUGUGGU
ENSRNOT00000003977 MI0004131 mmu-miR-551b GCGACCCAUACUUGGUUUCAG
ENSRNOT00000003977 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSRNOT00000003977 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSRNOT00000003977 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA
ENSRNOT00000003977 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENSRNOT00000003977 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENSRNOT00000003977 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENSRNOT00000003977 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSRNOT00000003977 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENSRNOT00000003977 MI0000908 rno-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSRNOT00000003977 MI0000645 rno-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENSRNOT00000003977 MI0006130 rno-miR-147 GUGUGCGGAAAUGCUUCUGCUA
ENSRNOT00000003977 MI0000845 rno-miR-17-3p ACUGCAGUGAAGGCACUUGUGG
ENSRNOT00000003977 MI0006133 rno-miR-182 UUUGGCAAUGGUAGAACUCACACCG
ENSRNOT00000003977 MI0000935 rno-miR-192 CUGACCUAUGAAUUGACAGCC
ENSRNOT00000003977 MI0000936 rno-miR-193 AACUGGCCUACAAAGUCCCAGU
ENSRNOT00000003977 MI0003554 rno-miR-20b-3p ACUGCAGUGUGAGCACUUCUGG
ENSRNOT00000003977 MI0003482 rno-miR-215 AUGACCUAUGAUUUGACAGAC
ENSRNOT00000003977 MI0000863 rno-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENSRNOT00000003977 MI0000862 rno-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENSRNOT00000003977 MI0000864 rno-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENSRNOT00000003977 MI0000865 rno-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSRNOT00000003977 MI0000972 rno-miR-320 AAAAGCUGGGUUGAGAGGGCGA
ENSRNOT00000003977 MI0000629 rno-miR-344-3p UGAUCUAGCCAAAGCCUGACCGU
ENSRNOT00000003977 MI0003541 rno-miR-379 UGGUAGACUAUGGAACGUAGG
ENSRNOT00000003977 MI0003527 rno-miR-541 AAGGGAUUCUGAUGUUGGUCACACU
ENSRNOT00000003977 MI0006116 rno-miR-871 UAUUCAGAUUGGUGCCGGUCACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Muguruma M, et al. (2008) "Threshold dose of piperonyl butoxide that induces reactive oxygen species-mediated hepatocarcinogenesis in rats." Arch Toxicol. ():. PMID:18648771
  2. [ + ] Petrovic V, et al. (2008) "Effect of endotoxin on the expression of placental drug transporters and glyburide disposition in pregnant rats." Drug Metab Dispos. 36(9):1944-1950. PMID:18505788
  3. [ + ] Merrell MD, et al. (2008) "Induction of drug metabolism enzymes and transporters by oltipraz in rats." J Biochem Mol Toxicol. 22(2):128-135. PMID:18418891
  4. [ + ] Okumura H, et al. (2007) "Change of drug excretory pathway by CCl4-induced liver dysfunction in rat." Biochem Pharmacol. 74(3):488-495. PMID:17544377
  5. [ + ] Ruiz ML, et al. (2006) "Ethynylestradiol increases expression and activity of rat liver MRP3." Drug Metab Dispos. 34(6):1030-1034. PMID:16554369
  6. [ + ] Nishimura M, et al. (2006) "Regulation of mRNA expression of MDR1, MRP1, MRP2 and MRP3 by prototypical microsomal enzyme inducers in primary cultures of human and rat hepatocytes." Drug Metab Pharmacokinet. 21(4):297-307. PMID:16946557
  7. [ + ] Chang TH, et al. (2004) "Expression of MRP2 and MRP3 during liver regeneration after 90% partial hepatectomy in rats." Transplantation. 77(1):22-27. PMID:14724430
  8. [ + ] Tamai M, et al. (2003) "Conjugated bilirubin induces multidrug resistance-associated protein 2 mRNA expression and in vivo cisplatin resistance in rat hepatoma AH66 cells." Anticancer Res. 23(6C):4781-4787. PMID:14981926
  9. [ + ] Li T, et al. (2003) "Transport of fluorescein methotrexate by multidrug resistance-associated protein 3 in IEC-6 cells." Am J Physiol Gastrointest Liver Physiol. 285(3):G602-G610. PMID:12909565
  10. [ + ] Bodo A, et al. (2003) "Differential modulation of the human liver conjugate transporters MRP2 and MRP3 by bile acids and organic anions." J Biol Chem. 278(26):23529-23537. PMID:12704183
  11. [ + ] Akita H, et al. (2002) "Transport activity of human MRP3 expressed in Sf9 cells: comparative studies with rat MRP3." Pharm Res. 19(1):34-41. PMID:11837698
  12. [ + ] Rost D, et al. (2002) "Expression and localization of the multidrug resistance-associated protein 3 in rat small and large intestine." Am J Physiol Gastrointest Liver Physiol. 282(4):G720-G726. PMID:11897632
  13. [ + ] Tzeng SJ, et al. (2002) "Transcriptional regulation of the rat Mrp3 promoter in intestine cells." Biochem Biophys Res Commun. 291(2):270-277. PMID:11846400
  14. [ + ] Ortiz DF, et al. (1999) "MRP3, a new ATP-binding cassette protein localized to the canalicular domain of the hepatocyte." Am J Physiol. 276(6 Pt 1):G1493-G1500. PMID:10362653
  15. [ + ] Hirohashi T, et al. (1998) "Hepatic expression of multidrug resistance-associated protein-like proteins maintained in eisai hyperbilirubinemic rats." Mol Pharmacol. 53(6):1068-1075. PMID:9614210