A1bg | GeneID:140656 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 140656 Official Symbol A1bg
Locus N/A Gene Type protein-coding
Synonyms C44
Full Name alpha-1-B glycoprotein
Description alpha-1-B glycoprotein
Chromosome 7q33
Also Known As liver regeneration-related protein 1
Summary may have a role in the immediate-early response phase of liver regeneration [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11167

ID Symbol Protein Species
GeneID:1 A1BG NP_570602.2 Homo sapiens
GeneID:117586 A1bg NP_001074536.1 Mus musculus
GeneID:140656 A1bg NP_071594.2 Rattus norvegicus
GeneID:484230 A1BG XP_541346.2 Canis lupus familiaris
GeneID:518955 A1BG NP_001039708.1 Bos taurus
GeneID:742390 A1BG XP_001146598.1 Pan troglodytes

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_022258  UCSC Browser NP_071594

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000006273 MI0003582 hsa-miR-575 GAGCCAGUUGGACAGGAGC
ENSRNOT00000006273 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENSRNOT00000006273 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSRNOT00000006273 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENSRNOT00000006273 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENSRNOT00000006273 MI0004131 mmu-miR-551b GCGACCCAUACUUGGUUUCAG
ENSRNOT00000006273 MI0004127 mmu-miR-592 AUUGUGUCAAUAUGCGAUGAUGU
ENSRNOT00000006273 MI0005520 mmu-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENSRNOT00000006273 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENSRNOT00000006273 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSRNOT00000006273 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG
ENSRNOT00000006273 MI0000601 rno-let-7d* CUAUACGACCUGCUGCCUUUCU
ENSRNOT00000006273 MI0000637 rno-miR-129 CUUUUUGCGGUCUGGGCUUGC
ENSRNOT00000006273 MI0000902 rno-miR-129 CUUUUUGCGGUCUGGGCUUGC
ENSRNOT00000006273 MI0000941 rno-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENSRNOT00000006273 MI0006147 rno-miR-434 UUUGAACCAUCACUCGACUCCU
ENSRNOT00000006273 MI0006164 rno-miR-760-3p CGGCUCUGGGUCUGUGGGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  3. [ + ] Gardmo C, et al. (2001) "Cloning of a novel growth hormone-regulated rat complementary deoxyribonucleic acid with homology to the human alpha1B-glycoprotein, characterizing a new protein family." Endocrinology. 142(6):2695-2701. PMID:11356721
  4. [ + ] Xu W, et al. (2000) "Identification and characterization of differentially expressed genes in the early response phase during liver regeneration." Biochem Biophys Res Commun. 278(2):318-325. PMID:11097837