A1bg | GeneID:140656 | Rattus norvegicus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 140656 | Official Symbol | A1bg |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | C44 | ||
| Full Name | alpha-1-B glycoprotein | ||
| Description | alpha-1-B glycoprotein | ||
| Chromosome | 7q33 | ||
| Also Known As | liver regeneration-related protein 1 | ||
| Summary | may have a role in the immediate-early response phase of liver regeneration [RGD] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 11167
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:1 | A1BG | NP_570602.2 | Homo sapiens |
| GeneID:117586 | A1bg | NP_001074536.1 | Mus musculus |
| GeneID:140656 | A1bg | NP_071594.2 | Rattus norvegicus |
| GeneID:484230 | A1BG | XP_541346.2 | Canis lupus familiaris |
| GeneID:518955 | A1BG | NP_001039708.1 | Bos taurus |
| GeneID:742390 | A1BG | XP_001146598.1 | Pan troglodytes |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSRNOT00000006273 | MI0003582 | hsa-miR-575 | GAGCCAGUUGGACAGGAGC |
| ENSRNOT00000006273 | MI0003611 | hsa-miR-599 | GUUGUGUCAGUUUAUCAAAC |
| ENSRNOT00000006273 | MI0003683 | hsa-miR-659 | CUUGGUUCAGGGAGGGUCCCCA |
| ENSRNOT00000006273 | MI0005712 | hsa-miR-920 | GGGGAGCUGUGGAAGCAGUA |
| ENSRNOT00000006273 | MI0005760 | hsa-miR-938 | UGCCCUUAAAGGUGAACCCAGU |
| ENSRNOT00000006273 | MI0004131 | mmu-miR-551b | GCGACCCAUACUUGGUUUCAG |
| ENSRNOT00000006273 | MI0004127 | mmu-miR-592 | AUUGUGUCAAUAUGCGAUGAUGU |
| ENSRNOT00000006273 | MI0005520 | mmu-miR-654-3p | UAUGUCUGCUGACCAUCACCUU |
| ENSRNOT00000006273 | MI0004662 | mmu-miR-693-5p | CAGCCACAUCCGAAAGUUUUC |
| ENSRNOT00000006273 | MI0004681 | mmu-miR-697 | AACAUCCUGGUCCUGUGGAGA |
| ENSRNOT00000006273 | MI0005204 | mmu-miR-805 | GAAUUGAUCAGGACAUAGGG |
| ENSRNOT00000006273 | MI0000601 | rno-let-7d* | CUAUACGACCUGCUGCCUUUCU |
| ENSRNOT00000006273 | MI0000637 | rno-miR-129 | CUUUUUGCGGUCUGGGCUUGC |
| ENSRNOT00000006273 | MI0000902 | rno-miR-129 | CUUUUUGCGGUCUGGGCUUGC |
| ENSRNOT00000006273 | MI0000941 | rno-miR-199a-5p | CCCAGUGUUCAGACUACCUGUUC |
| ENSRNOT00000006273 | MI0006147 | rno-miR-434 | UUUGAACCAUCACUCGACUCCU |
| ENSRNOT00000006273 | MI0006164 | rno-miR-760-3p | CGGCUCUGGGUCUGUGGGGA |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Gardmo C, et al. (2001) "Cloning of a novel growth hormone-regulated rat complementary deoxyribonucleic acid with homology to the human alpha1B-glycoprotein, characterizing a new protein family." Endocrinology. 142(6):2695-2701. PMID:11356721 - [
] Xu W, et al. (2000) "Identification and characterization of differentially expressed genes in the early response phase during liver regeneration." Biochem Biophys Res Commun. 278(2):318-325. PMID:11097837
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
A sex-specific secretion of GH prevails in the rat. This has bearings on the expression of target genes, particularly in the liver. We have used suppressive subtractive hybridization to search for genes expressed in response to the female-characteristic, near-continuous secretion of GH. One sequence was particularly abundant among the obtained clones. After isolation of the corresponding full-length complementary DNA using rapid amplification of complementary DNA ends, it was found to be homologous to the human alpha1B-glycoprotein. Sequence comparisons suggest that the human alpha1B-glycoprotein and the rat homolog are members of a new family of proteins, of which at least four additional forms were found in the databases of human and mouse expressed sequence tags. In situ hybridization confirmed the female-specific expression, and by RNase protection analysis a liver-specific expression was indicated. Up-regulation of the messenger RNA by continuous exposure to GH, but not to the male-characteristic intermittent exposure, was demonstrated in hypophysectomized rats and in cultured primary hepatocytes.
It has been suggested that the early response was a critical regulator of the remaining quiescent liver cells reentering the cell cycle after partial hepatectomy. The identification of genetic factors and function important in the early response phase during liver regeneration after partial hepatectomy will help in understanding the underlying molecular mechanisms of hepatic injuries. Through the application of complementary DNA representational difference analysis (RDA), we have identified genes that are up-regulated in early response phase during liver regeneration. Results from slot blot and Northern blot analysis confirmed that the RDA products were truly differentially expressed. In addition to well-characterized up-regulated genes during liver regeneration, including IGFBP-1, LRF-1, and metallothionein, we demonstrate the differential expression of at least 6 genes previously not known to be associated with liver regeneration. PC3 and TEC genes were identified as immediate-early response genes and were dramatically increased following partial hepatectomy. Ribosomal protein L6, ribosomal protein S7, chaperonin 10, and cytochrome oxidase I were identified to be up-regulated 4- to 5-fold after 70% partial hepatectomy. In addition to the known genes, 7 novel genes were isolated. Among them, two genes showed their up-regulation in liver regeneration by Northern blot analysis. One was exclusively expressed in liver, and no expression was observed in other tissues. Peak expression, 30-fold above baseline, occurred 60 min after 70% hepatectomy. Cycloheximide pretreatment could not suppress the induction of this gene, indicating that this gene as a novel immediate-early response gene following partial hepatectomy. The novel gene, which was represented three times in the differential clones, may be one of the highly up-expressed genes in regenerating liver. Its transcript is undetectable in normal liver; its level of mRNA increased by 0.5 h after 2/3 partial hepatectomy, reaching a maximum at 2 h. This gene is similar to human alpha-1-beta-glycoprotein (40%). These results suggest a role of these genes in the early response phase of liver regeneration.