AAMP | GeneID:14 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 14 Official Symbol AAMP
Locus N/A Gene Type protein-coding
Synonyms
Full Name angio-associated, migratory cell protein
Description angio-associated, migratory cell protein
Chromosome 2q35
Also Known As
Summary The gene product is an immunoglobulin-type protein. It is found to be expressed strongly in endothelial cells, cytotrophoblasts, and poorly differentiated colon adenocarcinoma cells found in lymphatics. The protein contains a heparin-binding domain and mediates heparin-sensitive cell adhesion. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 846

ID Symbol Protein Species
GeneID:14 AAMP NP_001078.2 Homo sapiens
GeneID:39624 CG5114 NP_648731.1 Drosophila melanogaster
GeneID:176680 Y111B2A.12 NP_499643.1 Caenorhabditis elegans
GeneID:227290 Aamp NP_666222.2 Mus musculus
GeneID:301512 Aamp XP_217441.4 Rattus norvegicus
GeneID:405874 zgc:85939 NP_998103.1 Danio rerio
GeneID:459940 AAMP XP_001154321.1 Pan troglodytes
GeneID:478908 AAMP NP_001013872.1 Canis lupus familiaris
GeneID:767919 AAMP NP_001070463.1 Bos taurus
GeneID:769880 AAMP XP_001233195.1 Gallus gallus
GeneID:843514 AT1G71840 NP_177329.2 Arabidopsis thaliana
GeneID:1268314 ENSANGG00000011272 XP_306869.2 Anopheles gambiae
GeneID:1278314 AgaP_AGAP011387 XP_317937.2 Anopheles gambiae
GeneID:2542715 SPAC25H1.08c NP_593812.1 Schizosaccharomyces pombe
GeneID:4333750 Os03g0685600 NP_001050927.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abnova H00000014-M02 AAMP monoclonal antibody (M02), clone 2H2; Mouse monoclonal antibody raised against a partial recombinant AAMP.

Exon, Intron and UTRs

Exon, Intron and UTRs of AAMP Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AAMP Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0009986 Component cell surface
GO:0005737 Component cytoplasm
GO:0005886 Component plasma membrane
GO:0008201 Function heparin binding
GO:0001525 Process angiogenesis
GO:0030154 Process cell differentiation
GO:0007275 Process multicellular organismal development
GO:0010595 Process positive regulation of endothelial cell migration
GO:0014909 Process smooth muscle cell migration

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001087  UCSC Browser NP_001078

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000248450 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENST00000248450 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENST00000248450 MI0000471 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG
ENST00000248450 MI0000748 hsa-miR-130b* ACUCUUUCCCUGUUGCACUAC
ENST00000248450 MI0000449 hsa-miR-132* ACCGUGGCUUUCGAUUGUUACU
ENST00000248450 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000248450 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000248450 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENST00000248450 MI0000476 hsa-miR-138-1* GCUACUUCACAACACCAGGGCC
ENST00000248450 MI0000477 hsa-miR-146a* CCUCUGAAAUUCAGUUCUUCAG
ENST00000248450 MI0003129 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG
ENST00000248450 MI0000478 hsa-miR-149* AGGGAGGGACGGGGGCUGUGC
ENST00000248450 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENST00000248450 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENST00000248450 MI0001518 hsa-miR-18b* UGCCCUAAAUGCCCCUUCUGGC
ENST00000248450 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENST00000248450 MI0000284 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENST00000248450 MI0000077 hsa-miR-21* CAACACCAGUCGAUGGGCUGU
ENST00000248450 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENST00000248450 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENST00000248450 MI0000295 hsa-miR-218-2* CAUGGUUCUGUCAAGCACCGCG
ENST00000248450 MI0000080 hsa-miR-24-1* UGCCUACUGAGCUGAUAUCAGU
ENST00000248450 MI0000081 hsa-miR-24-2* UGCCUACUGAGCUGAAACACAG
ENST00000248450 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENST00000248450 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENST00000248450 MI0000738 hsa-miR-302a* ACUUAAACGUGGAUGUACUUGCU
ENST00000248450 MI0000772 hsa-miR-302b* ACUUUAACAUGGAAGUGCUUUC
ENST00000248450 MI0000774 hsa-miR-302d* ACUUUAACAUGGAGGCACUUGC
ENST00000248450 MI0000441 hsa-miR-30b* CUGGGAGGUGGAUGUUUACUUC
ENST00000248450 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENST00000248450 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENST00000248450 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENST00000248450 MI0000805 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENST00000248450 MI0000743 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG
ENST00000248450 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENST00000248450 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENST00000248450 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENST00000248450 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENST00000248450 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENST00000248450 MI0002469 hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC
ENST00000248450 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000248450 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENST00000248450 MI0003161 hsa-miR-517* CCUCUAGAUGGAAGCACUGUCU
ENST00000248450 MI0003165 hsa-miR-517* CCUCUAGAUGGAAGCACUGUCU
ENST00000248450 MI0003174 hsa-miR-517* CCUCUAGAUGGAAGCACUGUCU
ENST00000248450 MI0003159 hsa-miR-518c* UCUCUGGAGGGAAGCACUUUCUG
ENST00000248450 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENST00000248450 MI0003169 hsa-miR-518e* CUCUAGAGGGAAGCGCUUUCUG
ENST00000248450 MI0003154 hsa-miR-518f* CUCUAGAGGGAAGCACUUUCUC
ENST00000248450 MI0003600 hsa-miR-550* UGUCUUACUCCCUCAGGCACAU
ENST00000248450 MI0003601 hsa-miR-550* UGUCUUACUCCCUCAGGCACAU
ENST00000248450 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000248450 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENST00000248450 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENST00000248450 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENST00000248450 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENST00000248450 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENST00000248450 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENST00000248450 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENST00000248450 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENST00000248450 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENST00000248450 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENST00000248450 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENST00000248450 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENST00000248450 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENST00000248450 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000248450 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENST00000248450 MI0005561 hsa-miR-877* UCCUCUUCUCCCUCCUCCCAG
ENST00000248450 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENST00000248450 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENST00000248450 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENST00000248450 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENST00000248450 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENST00000248450 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENST00000248450 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENST00000248450 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000248450 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000248450 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000248450 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000248450 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000248450 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000248450 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000248450 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000248450 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENST00000248450 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENST00000248450 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENST00000248450 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENST00000248450 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENST00000248450 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENST00000248450 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENST00000248450 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENST00000248450 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENST00000248450 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENST00000248450 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU
ENST00000248450 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU
ENST00000248450 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
bicalutamide
  • bicalutamide results in increased expression of AAMP mRNA
16631469

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Prostatic Neoplasms inferred via bicalutamide 17914592

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Vogt F, et al. (2008) "Blockade of angio-associated migratory cell protein inhibits smooth muscle cell migration and neointima formation in accelerated atherosclerosis." J Am Coll Cardiol. 52(4):302-311. PMID:18634987
  2. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  3. [ + ] Brandenberger R, et al. (2004) "Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation." Nat Biotechnol. 22(6):707-716. PMID:15146197
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Beckner ME, et al. (2002) "Extracellular angio-associated migratory cell protein plays a positive role in angiogenesis and is regulated by astrocytes in coculture." Microvasc Res. 63(3):259-269. PMID:11969303
  6. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  7. [ + ] Beckner ME, et al. (1999) "Angio-associated migratory cell protein is expressed as an extracellular protein by blood-vessel-associated mesenchymal cells." Microvasc Res. 57(3):347-352. PMID:10329261
  8. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  9. [ + ] Beckner ME, et al. (1996) "AAMP, a newly identified protein, shares a common epitope with alpha-actinin and a fast skeletal muscle fiber protein." Exp Cell Res. 225(2):306-314. PMID:8660919
  10. [ + ] Beckner ME, et al. (1995) "Identification of a new immunoglobulin superfamily protein expressed in blood vessels with a heparin-binding consensus sequence." Cancer Res. 55(10):2140-2149. PMID:7743515
  11. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298