AAMP | GeneID:14 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 14 | Official Symbol | AAMP |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | |||
| Full Name | angio-associated, migratory cell protein | ||
| Description | angio-associated, migratory cell protein | ||
| Chromosome | 2q35 | ||
| Also Known As | |||
| Summary | The gene product is an immunoglobulin-type protein. It is found to be expressed strongly in endothelial cells, cytotrophoblasts, and poorly differentiated colon adenocarcinoma cells found in lymphatics. The protein contains a heparin-binding domain and mediates heparin-sensitive cell adhesion. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 846
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:14 | AAMP | NP_001078.2 | Homo sapiens |
| GeneID:39624 | CG5114 | NP_648731.1 | Drosophila melanogaster |
| GeneID:176680 | Y111B2A.12 | NP_499643.1 | Caenorhabditis elegans |
| GeneID:227290 | Aamp | NP_666222.2 | Mus musculus |
| GeneID:301512 | Aamp | XP_217441.4 | Rattus norvegicus |
| GeneID:405874 | zgc:85939 | NP_998103.1 | Danio rerio |
| GeneID:459940 | AAMP | XP_001154321.1 | Pan troglodytes |
| GeneID:478908 | AAMP | NP_001013872.1 | Canis lupus familiaris |
| GeneID:767919 | AAMP | NP_001070463.1 | Bos taurus |
| GeneID:769880 | AAMP | XP_001233195.1 | Gallus gallus |
| GeneID:843514 | AT1G71840 | NP_177329.2 | Arabidopsis thaliana |
| GeneID:1268314 | ENSANGG00000011272 | XP_306869.2 | Anopheles gambiae |
| GeneID:1278314 | AgaP_AGAP011387 | XP_317937.2 | Anopheles gambiae |
| GeneID:2542715 | SPAC25H1.08c | NP_593812.1 | Schizosaccharomyces pombe |
| GeneID:4333750 | Os03g0685600 | NP_001050927.1 | Oryza sativa |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abnova | H00000014-M02 | AAMP monoclonal antibody (M02), clone 2H2; Mouse monoclonal antibody raised against a partial recombinant AAMP. |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0009986 | Component | cell surface |
| GO:0005737 | Component | cytoplasm |
| GO:0005886 | Component | plasma membrane |
| GO:0008201 | Function | heparin binding |
| GO:0001525 | Process | angiogenesis |
| GO:0030154 | Process | cell differentiation |
| GO:0007275 | Process | multicellular organismal development |
| GO:0010595 | Process | positive regulation of endothelial cell migration |
| GO:0014909 | Process | smooth muscle cell migration |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000248450 | MI0000111 | hsa-miR-105 | UCAAAUGCUCAGACUCCUGUGGU |
| ENST00000248450 | MI0000112 | hsa-miR-105 | UCAAAUGCUCAGACUCCUGUGGU |
| ENST00000248450 | MI0000471 | hsa-miR-126 | UCGUACCGUGAGUAAUAAUGCG |
| ENST00000248450 | MI0000748 | hsa-miR-130b* | ACUCUUUCCCUGUUGCACUAC |
| ENST00000248450 | MI0000449 | hsa-miR-132* | ACCGUGGCUUUCGAUUGUUACU |
| ENST00000248450 | MI0000450 | hsa-miR-133a | UUUGGUCCCCUUCAACCAGCUG |
| ENST00000248450 | MI0000451 | hsa-miR-133a | UUUGGUCCCCUUCAACCAGCUG |
| ENST00000248450 | MI0000822 | hsa-miR-133b | UUUGGUCCCCUUCAACCAGCUA |
| ENST00000248450 | MI0000476 | hsa-miR-138-1* | GCUACUUCACAACACCAGGGCC |
| ENST00000248450 | MI0000477 | hsa-miR-146a* | CCUCUGAAAUUCAGUUCUUCAG |
| ENST00000248450 | MI0003129 | hsa-miR-146b-3p | UGCCCUGUGGACUCAGUUCUGG |
| ENST00000248450 | MI0000478 | hsa-miR-149* | AGGGAGGGACGGGGGCUGUGC |
| ENST00000248450 | MI0000482 | hsa-miR-185 | UGGAGAGAAAGGCAGUUCCUGA |
| ENST00000248450 | MI0000484 | hsa-miR-188-3p | CUCCCACAUGCAGGGUUUGCA |
| ENST00000248450 | MI0001518 | hsa-miR-18b* | UGCCCUAAAUGCCCCUUCUGGC |
| ENST00000248450 | MI0000487 | hsa-miR-193a-5p | UGGGUCUUUGCGGGCGAGAUGA |
| ENST00000248450 | MI0000284 | hsa-miR-204 | UUCCCUUUGUCAUCCUAUGCCU |
| ENST00000248450 | MI0000077 | hsa-miR-21* | CAACACCAGUCGAUGGGCUGU |
| ENST00000248450 | MI0000287 | hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU |
| ENST00000248450 | MI0000292 | hsa-miR-216a | UAAUCUCAGCUGGCAACUGUGA |
| ENST00000248450 | MI0000295 | hsa-miR-218-2* | CAUGGUUCUGUCAAGCACCGCG |
| ENST00000248450 | MI0000080 | hsa-miR-24-1* | UGCCUACUGAGCUGAUAUCAGU |
| ENST00000248450 | MI0000081 | hsa-miR-24-2* | UGCCUACUGAGCUGAAACACAG |
| ENST00000248450 | MI0000747 | hsa-miR-296-5p | AGGGCCCCCCCUCAAUCCUGU |
| ENST00000248450 | MI0005525 | hsa-miR-300 | UAUACAAGGGCAGACUCUCUCU |
| ENST00000248450 | MI0000738 | hsa-miR-302a* | ACUUAAACGUGGAUGUACUUGCU |
| ENST00000248450 | MI0000772 | hsa-miR-302b* | ACUUUAACAUGGAAGUGCUUUC |
| ENST00000248450 | MI0000774 | hsa-miR-302d* | ACUUUAACAUGGAGGCACUUGC |
| ENST00000248450 | MI0000441 | hsa-miR-30b* | CUGGGAGGUGGAUGUUUACUUC |
| ENST00000248450 | MI0001725 | hsa-miR-329 | AACACACCUGGUUAACCUCUUU |
| ENST00000248450 | MI0001726 | hsa-miR-329 | AACACACCUGGUUAACCUCUUU |
| ENST00000248450 | MI0000803 | hsa-miR-330-5p | UCUCUGGGCCUGUGUCUUAGGC |
| ENST00000248450 | MI0000805 | hsa-miR-342-3p | UCUCACACAGAAAUCGCACCCGU |
| ENST00000248450 | MI0000743 | hsa-miR-34c-3p | AAUCACUAACCACACGGCCAGG |
| ENST00000248450 | MI0000762 | hsa-miR-362-3p | AACACACCUAUUCAAGGAUUCA |
| ENST00000248450 | MI0000779 | hsa-miR-371-5p | ACUCAAACUGUGGGGGCACU |
| ENST00000248450 | MI0000789 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| ENST00000248450 | MI0002467 | hsa-miR-483-3p | UCACUCCUCUCCUCCCGUCUU |
| ENST00000248450 | MI0002469 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
| ENST00000248450 | MI0002469 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
| ENST00000248450 | MI0002470 | hsa-miR-486-3p | CGGGGCAGCUCAGUACAGGAU |
| ENST00000248450 | MI0003124 | hsa-miR-489 | GUGACAUCACAUAUACGGCAGC |
| ENST00000248450 | MI0003161 | hsa-miR-517* | CCUCUAGAUGGAAGCACUGUCU |
| ENST00000248450 | MI0003165 | hsa-miR-517* | CCUCUAGAUGGAAGCACUGUCU |
| ENST00000248450 | MI0003174 | hsa-miR-517* | CCUCUAGAUGGAAGCACUGUCU |
| ENST00000248450 | MI0003159 | hsa-miR-518c* | UCUCUGGAGGGAAGCACUUUCUG |
| ENST00000248450 | MI0003171 | hsa-miR-518d-5p | CUCUAGAGGGAAGCACUUUCUG |
| ENST00000248450 | MI0003169 | hsa-miR-518e* | CUCUAGAGGGAAGCGCUUUCUG |
| ENST00000248450 | MI0003154 | hsa-miR-518f* | CUCUAGAGGGAAGCACUUUCUC |
| ENST00000248450 | MI0003600 | hsa-miR-550* | UGUCUUACUCCCUCAGGCACAU |
| ENST00000248450 | MI0003601 | hsa-miR-550* | UGUCUUACUCCCUCAGGCACAU |
| ENST00000248450 | MI0003590 | hsa-miR-583 | CAAAGAGGAAGGUCCCAUUAC |
| ENST00000248450 | MI0003599 | hsa-miR-589 | UGAGAACCACGUCUGCUCUGAG |
| ENST00000248450 | MI0003605 | hsa-miR-593 | UGUCUCUGCUGGGGUUUCU |
| ENST00000248450 | MI0003615 | hsa-miR-602 | GACACGGGCGACAGCUGCGGCCC |
| ENST00000248450 | MI0003616 | hsa-miR-603 | CACACACUGCAAUUACUUUUGC |
| ENST00000248450 | MI0003625 | hsa-miR-612 | GCUGGGCAGGGCUUCUGAGCUCCUU |
| ENST00000248450 | MI0003627 | hsa-miR-614 | GAACGCCUGUUCUUGCCAGGUGG |
| ENST00000248450 | MI0003628 | hsa-miR-615-5p | GGGGGUCCCCGGUGCUCGGAUC |
| ENST00000248450 | MI0003641 | hsa-miR-627 | GUGAGUCUCUAAGAAAAGAGGA |
| ENST00000248450 | MI0003649 | hsa-miR-634 | AACCAGCACCCCAACUUUGGAC |
| ENST00000248450 | MI0003650 | hsa-miR-635 | ACUUGGGCACUGAAACAAUGUCC |
| ENST00000248450 | MI0003657 | hsa-miR-642 | GUCCCUCUCCAAAUGUGUCUUG |
| ENST00000248450 | MI0003681 | hsa-miR-657 | GGCAGGUUCUCACCCUCUCUAGG |
| ENST00000248450 | MI0003682 | hsa-miR-658 | GGCGGAGGGAAGUAGGUCCGUUGGU |
| ENST00000248450 | MI0003672 | hsa-miR-663 | AGGCGGGGCGCCGCGGGACCGC |
| ENST00000248450 | MI0005541 | hsa-miR-875-3p | CCUGGAAACACUGAGGUUGUG |
| ENST00000248450 | MI0005561 | hsa-miR-877* | UCCUCUUCUCCCUCCUCCCAG |
| ENST00000248450 | MI0005562 | hsa-miR-887 | GUGAACGGGCGCCAUCCCGAGG |
| ENST00000248450 | MI0005540 | hsa-miR-889 | UUAAUAUCGGACAACCAUUGU |
| ENST00000248450 | MI0005762 | hsa-miR-940 | AAGGCAGGGCCCCCGCUCCCC |
| ENST00000248450 | MI0000388 | mmu-miR-290-5p | ACUCAAACUAUGGGGGCACUUU |
| ENST00000248450 | MI0000390 | mmu-miR-292-3p | AAAGUGCCGCCAGGUUUUGAGUGU |
| ENST00000248450 | MI0000390 | mmu-miR-292-5p | ACUCAAACUGGGGGCUCUUUUG |
| ENST00000248450 | MI0005494 | mmu-miR-343 | UCUCCCUUCAUGUGCCCAGA |
| ENST00000248450 | MI0002401 | mmu-miR-466a-3p | UAUACAUACACGCACACAUAAGA |
| ENST00000248450 | MI0005504 | mmu-miR-466b-3-3p | AAUACAUACACGCACACAUAAGA |
| ENST00000248450 | MI0005546 | mmu-miR-466d-3p | UAUACAUACACGCACACAUAG |
| ENST00000248450 | MI0005507 | mmu-miR-466f-3p | CAUACACACACACAUACACAC |
| ENST00000248450 | MI0005508 | mmu-miR-466f-3p | CAUACACACACACAUACACAC |
| ENST00000248450 | MI0005509 | mmu-miR-466f-3p | CAUACACACACACAUACACAC |
| ENST00000248450 | MI0005510 | mmu-miR-466g | AUACAGACACAUGCACACACA |
| ENST00000248450 | MI0004553 | mmu-miR-666-3p | GGCUGCAGCGUGAUCGCCUGCU |
| ENST00000248450 | MI0004196 | mmu-miR-667 | UGACACCUGCCACCCAGCCCAAG |
| ENST00000248450 | MI0004601 | mmu-miR-673-3p | UCCGGGGCUGAGUUCUGUGCACC |
| ENST00000248450 | MI0004660 | mmu-miR-692 | AUCUCUUUGAGCGCCUCACUC |
| ENST00000248450 | MI0004661 | mmu-miR-692 | AUCUCUUUGAGCGCCUCACUC |
| ENST00000248450 | MI0004684 | mmu-miR-700 | CACGCGGGAACCGAGUCCACC |
| ENST00000248450 | MI0004686 | mmu-miR-702 | UGCCCACCCUUUACCCCGCUC |
| ENST00000248450 | MI0004689 | mmu-miR-705 | GGUGGGAGGUGGGGUGGGCA |
| ENST00000248450 | MI0004699 | mmu-miR-714 | CGACGAGGGCCGGUCGGUCGC |
| ENST00000248450 | MI0004704 | mmu-miR-717 | CUCAGACAGAGAUACCUUCUCU |
| ENST00000248450 | MI0004215 | mmu-miR-762 | GGGGCUGGGGCCGGGACAGAGC |
| ENST00000248450 | MI0005475 | mmu-miR-882 | AGGAGAGAGUUAGCGCAUUAGU |
| ENST00000248450 | MI0000613 | rno-miR-336 | UCACCCUUCCAUAUCUAGUCU |
| ENST00000248450 | MI0000635 | rno-miR-347 | UGUCCCUCUGGGUCGCCCA |
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| bicalutamide | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Disease Name | Relationship | PubMed |
|---|---|---|
| Prostatic Neoplasms | inferred via bicalutamide | 17914592 |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Vogt F, et al. (2008) "Blockade of angio-associated migratory cell protein inhibits smooth muscle cell migration and neointima formation in accelerated atherosclerosis." J Am Coll Cardiol. 52(4):302-311. PMID:18634987 - [
] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560 - [
] Brandenberger R, et al. (2004) "Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation." Nat Biotechnol. 22(6):707-716. PMID:15146197 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Beckner ME, et al. (2002) "Extracellular angio-associated migratory cell protein plays a positive role in angiogenesis and is regulated by astrocytes in coculture." Microvasc Res. 63(3):259-269. PMID:11969303 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Beckner ME, et al. (1999) "Angio-associated migratory cell protein is expressed as an extracellular protein by blood-vessel-associated mesenchymal cells." Microvasc Res. 57(3):347-352. PMID:10329261 - [
] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149 - [
] Beckner ME, et al. (1996) "AAMP, a newly identified protein, shares a common epitope with alpha-actinin and a fast skeletal muscle fiber protein." Exp Cell Res. 225(2):306-314. PMID:8660919 - [
] Beckner ME, et al. (1995) "Identification of a new immunoglobulin superfamily protein expressed in blood vessels with a heparin-binding consensus sequence." Cancer Res. 55(10):2140-2149. PMID:7743515 - [
] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298
OBJECTIVES: The aim of this study was to elucidate the role of angio-associated migratory cell protein (AAMP) for the migration of vascular smooth muscle cells (SMCs) and for the development of neointimal hyperplasia after vascular injury. BACKGROUND: Although AAMP has been shown to participate in angiogenesis and cancerogenesis and is predominantly expressed in cells with a migratory phenotype, involvement of AAMP during neointima (NI) formation after arterial injury has not been analyzed previously. METHODS: The AAMP content in SMCs was examined using 2-photon laser-scanning microscopy and subcellular fractioning. Migratory potential of SMCs transiently transfected with AAMP expression vectors, transfected with small interfering ribonucleic acid (siRNA), or treated with antirecombinant angio-associated migratory cell protein-antibody (anti-rAAMP-ab) was examined using transwell migration chamber assays. Expression of AAMP was determined in the atherogenic apolipoprotein E knockout (apoE(-/-)) mouse model and in the porcine coronary restenosis model by immunohistochemistry and by Western blot. ApoE(-/-) mice were treated intraperitoneally with anti-rAAMP-ab, and wire-injured carotid arteries were examined. RESULTS: Angio-associated migratory cell protein is localized in the membrane of SMCs, and its expression is enhanced in NI-derived SMCs. The AAMP overexpression increases, while both treatment with anti-rAAMP-ab and transfection with siRNA decreases SMC migration. Knockdown of AAMP decreases RhoA activity in the membrane fraction of SMCs. The AAMP expression by SMCs is enhanced in both animal models. Anti-rAAMP-ab reduces neointimal SMC density at 1 week and NI formation at 4 weeks in apoE(-/-) mice without affecting proliferation of SMCs. CONCLUSIONS: These data reveal an important functional role of AAMP in the migration of SMCs, identifying AAMP as a potential target to limit lesion formation after injury.
By analyzing 1,780,295 5'-end sequences of human full-length cDNAs derived from 164 kinds of oligo-cap cDNA libraries, we identified 269,774 independent positions of transcriptional start sites (TSSs) for 14,628 human RefSeq genes. These TSSs were clustered into 30,964 clusters that were separated from each other by more than 500 bp and thus are very likely to constitute mutually distinct alternative promoters. To our surprise, at least 7674 (52%) human RefSeq genes were subject to regulation by putative alternative promoters (PAPs). On average, there were 3.1 PAPs per gene, with the composition of one CpG-island-containing promoter per 2.6 CpG-less promoters. In 17% of the PAP-containing loci, tissue-specific use of the PAPs was observed. The richest tissue sources of the tissue-specific PAPs were testis and brain. It was also intriguing that the PAP-containing promoters were enriched in the genes encoding signal transduction-related proteins and were rarer in the genes encoding extracellular proteins, possibly reflecting the varied functional requirement for and the restricted expression of those categories of genes, respectively. The patterns of the first exons were highly diverse as well. On average, there were 7.7 different splicing types of first exons per locus partly produced by the PAPs, suggesting that a wide variety of transcripts can be achieved by this mechanism. Our findings suggest that use of alternate promoters and consequent alternative use of first exons should play a pivotal role in generating the complexity required for the highly elaborated molecular systems in humans.
Human embryonic stem (hES) cells hold promise for generating an unlimited supply of cells for replacement therapies. To characterize hES cells at the molecular level, we obtained 148,453 expressed sequence tags (ESTs) from undifferentiated hES cells and three differentiated derivative subpopulations. Over 32,000 different transcripts expressed in hES cells were identified, of which more than 16,000 do not match closely any gene in the UniGene public database. Queries to this EST database revealed 532 significantly upregulated and 140 significantly downregulated genes in undifferentiated hES cells. These data highlight changes in the transcriptional network that occur when hES cells differentiate. Among the differentially regulated genes are several components of signaling pathways and transcriptional regulators that likely play key roles in hES cell growth and differentiation. The genomic data presented here may facilitate the derivation of clinically useful cell types from hES cells.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
The extracellular form of angio-associated migratory cell protein (AAMP), a recently discovered protein, plays a positive role in angiogenesis and can be regulated by astrocytes. Angiogenic activities are inhibited by an affinity-purified, polyclonal antibody generated to recombinant AAMP. Inhibition of endothelial cell tube formation was previously shown and now endothelial cell migration assays using this antibody show dose-dependent inhibition (75%) of endothelial cell migration. Also, antisense inhibition has been used to determine the effects of reducing total AAMP (extracellular and intracellular forms). An AAMP-specific antisense oligonucleotide that targets a region near its amino terminus, anti-MES, inhibits (45%) total AAMP production by bovine aortic endothelial cells (BAECs), compared to a negative control oligonucleotide. Paradoxically, comparable use of antisense-MES results in a 27% increase in BAEC motility. Decreased cellular production of total AAMP (via antisense) that results in an increase of endothelial migration contrasts with antibody inhibition of extracellular AAMP that decreases migration. This indicates compartment-specific roles for AAMP in angiogenesis. Transwell cocultures of human astrocytes and BAECs increase (53%) the amount of extracellular AAMP found associated with endothelial cells. Therefore, regulation of extracellular AAMP by astrocytes is hypothesized to aid in angiogenesis of the nervous system. Extracellular AAMP's positive role may be either as a promoter or as a permissive protein in this process.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
Using 'oligo-capped' mRNA [Maruyama, K., Sugano, S., 1994. Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene 138, 171-174], whose cap structure was replaced by a synthetic oligonucleotide, we constructed two types of cDNA library. One is a 'full length-enriched cDNA library' which has a high content of full-length cDNA clones and the other is a '5'-end-enriched cDNA library', which has a high content of cDNA clones with their mRNA start sites. The 5'-end-enriched library was constructed especially for isolating the mRNA start sites of long mRNAs. In order to characterize these libraries, we performed one-pass sequencing of randomly selected cDNA clones from both libraries (84 clones for the full length-enriched cDNA library and 159 clones for the 5'-end-enriched cDNA library). The cDNA clones of the polypeptide chain elongation factor 1 alpha were most frequently (nine clones) isolated, and more than 80% of them (eight clones) contained the mRNA start site of the gene. Furthermore, about 80% of the cDNA clones of both libraries whose sequence matched with known genes had the known 5' ends or sequences upstream of the known 5' ends (28 out of 35 for the full length-enriched library and 51 out of 62 for the 5'-end-enriched library). The longest full-length clone of the full length-enriched cDNA library was about 3300 bp (among 28 clones). In contrast, seven clones (out of the 51 clones with the mRNA start sites) from the 5'-end-enriched cDNA library came from mRNAs whose length is more than 3500 bp. These cDNA libraries may be useful for generating 5' ESTs with the information of the mRNA start sites that are now scarce in the EST database.
AAMP (angio-associated migratory cell protein) shares a common epitope with alpha-actinin and a fast-twitch skeletal muscle fiber protein. An antigenic peptide, P189, derived from the sequence of AAMP was synthesized. Polyclonal antibodies generated to P189 readily react with AAMP (52 kDa) in brain and activated T lymphocyte lysates, alpha-actinin (100 kDa) in all tissues tested, and a 23-kDa protein in skeletal muscle lysates. The antibody's reactivity for alpha-actinin can be competed with the purified protein. Activation of T lymphocytes does not alter the degree of alpha-actinin reactivity with anti-P189 as it does for AAMP's reactivity in these lysates. Competition studies with peptide variants show that six amino acid residues, ESESES, constitute a common epitope in all three proteins in human tissues. The antigenic determinant is continuous in AAMP but discontinuous (or assembled) in alpha-actinin. alpha-Actinin does not contain this epitope in its linear sequence so reactivity is attributed to an epitope formed by its secondary structure. Limited digestion of the reactive proteins with thermolysin destroys anti-P189's reactivity for alpha-actinin while reactivity for recombinant AAMP is retained. Specificity of anti-P189 for human skeletal muscle fast fibers seen on immunoperoxidase staining may be explained by anti-P189's reactivity with a 23-kDa protein found only in skeletal muscle lysates. Its pattern of reactivity is the same as that obtained using monoclonal anti-skeletal muscle myosin heavy chain in type II (fast-twitch) fibers.
A novel immunoglobulin-type protein expressed in blood vessels has been identified. The cDNA for AAMP (angio-associated, migratory cell protein) was first isolated from a human melanoma cell line during a search for motility-associated cell surface proteins. Upon analysis of the tissue distribution of AAMP, it was found to be expressed strongly in endothelial cells, cytotrophoblasts, and poorly differentiated colon adenocarcinoma cells found in lymphatics. The sequence of AAMP predicts a protein (M(r) 49,000) with distant identity (25%) to known proteins. It contains immunoglobulin-like domains [one with multiple homologies to deleted in colon carcinoma (DCC) protein], the WD40 repeat motif, and a heparin-binding consensus sequence. A 1.6-kilobase mRNA transcript of AAMP is detected in tissue culture cell lines and tissues. Affinity-purified polyclonal antibodies, anti-recombinant AAMP, and anti-peptide 189 (AAMP derived) recognize a M(r) 52,000 protein in human tissue and cellular extracts. The protein size is in keeping with the mRNA and predicted sequence. The AAMP-derived peptide, P189, contains a heparin-binding domain (dissociation constant, 14 pmol) and mediates heparin-sensitive cell adhesion. The shared expression of AAMP in endothelial cells, trophoblasts, and tumor cells implies a common function in migrating cells.
We have devised a method to replace the cap structure of a mRNA with an oligoribonucleotide (r-oligo) to label the 5' end of eukaryotic mRNAs. The method consists of removing the cap with tobacco acid pyrophosphatase (TAP) and ligating r-oligos to decapped mRNAs with T4 RNA ligase. This reaction was made cap-specific by removing 5'-phosphates of non-capped RNAs with alkaline phosphatase prior to TAP treatment. Unlike the conventional methods that label the 5' end of cDNAs, this method specifically labels the capped end of the mRNAs with a synthetic r-oligo prior to first-strand cDNA synthesis. The 5' end of the mRNA was identified quite simply by reverse transcription-polymerase chain reaction (RT-PCR).

