ABRA | GeneID:137735 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 137735 Official Symbol ABRA
Locus N/A Gene Type protein-coding
Synonyms STARS
Full Name actin-binding Rho activating protein
Description actin-binding Rho activating protein
Chromosome 8q23.1
Also Known As striated muscle activator of Rho-dependent signaling
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 34713

ID Symbol Protein Species
GeneID:137735 ABRA NP_631905.1 Homo sapiens
GeneID:172722 F36F2.1 NP_492426.1 Caenorhabditis elegans
GeneID:223513 Abra NP_780665.1 Mus musculus
GeneID:286965 Abra NP_787038.1 Rattus norvegicus
GeneID:430953 ABRA XP_428503.1 Gallus gallus
GeneID:445477 zgc:92005 NP_001003986.1 Danio rerio
GeneID:472838 ABRA XP_528210.1 Pan troglodytes
GeneID:481999 ABRA XP_539120.2 Canis lupus familiaris
GeneID:539379 ABRA XP_586763.1 Bos taurus
GeneID:1281661 AgaP_AGAP001515 XP_321607.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma HPA017724 Anti-ABRA antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABRA Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABRA Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0015629 Component actin cytoskeleton
GO:0005737 Component cytoplasm
GO:0005886 Component plasma membrane
GO:0030017 Component sarcomere
GO:0003779 Function actin binding
GO:0003713 Function transcription coactivator activity
GO:0065002 Process intracellular protein transmembrane transport
GO:0035025 Process positive regulation of Rho protein signal transduction
GO:0045941 Process positive regulation of transcription
GO:0051091 Process positive regulation of transcription factor activity
GO:0045944 Process positive regulation of transcription from RNA polymerase II promoter
GO:0000060 Process protein import into nucleus, translocation
GO:0015031 Process protein transport
GO:0006355 Process regulation of transcription, DNA-dependent

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_139166  UCSC Browser NP_631905

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000311955 MI0000267 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENST00000311955 MI0000737 hsa-miR-200a* CAUCUUACCGGACAGUGCUGGA
ENST00000311955 MI0000342 hsa-miR-200b* CAUCUUACUGGGCAGCAUUGGA
ENST00000311955 MI0000772 hsa-miR-302b* ACUUUAACAUGGAAGUGCUUUC
ENST00000311955 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000311955 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000311955 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENST00000311955 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENST00000311955 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENST00000311955 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENST00000311955 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Doxorubicin
  • Doxorubicin results in increased expression of ABRA mRNA
16243910

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Cardiomyopathy, Dilated marker 16243910
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 15939500, 16826403, 18382427, 17369602, 16264153, 15994142, 15136595, 11325840, 16322301, 16096432, 15993339, 15634643, 15567936, 15668708, 18234424, 16935488, 18628466, 17983394, 17426702
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 17876044, 16023760, 16234567
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 17308081, 15811867, 17007740, 17382496, 16731534, 16109756, 16242529, 16364871, 16651473, 17351982, 17131338, 16455267, 18627295, 17329180, 15505089, 16278810, 15476868, 16269455, 17974986
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16330681, 16879835, 16244372, 16244371, 16144979
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 18501091, 15147373
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 16868541, 15749863, 18437689, 16888761, 16729912
Sarcoma inferred via Doxorubicin 18313854, 15625365, 16767912, 17203757, 15675481, 17710206
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 17203757, 15625365
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kuwahara K, et al. (2007) "Modulation of adverse cardiac remodeling by STARS, a mediator of MEF2 signaling and SRF activity." J Clin Invest. 117(5):1324-1334. PMID:17415416
  2. [ + ] Mehrle A, et al. (2006) "The LIFEdb database in 2006." Nucleic Acids Res. 34(Database issue):D415-D418. PMID:16381901
  3. [ + ] Kuwahara K, et al. (2005) "Muscle-specific signaling mechanism that links actin dynamics to serum response factor." Mol Cell Biol. 25(8):3173-3181. PMID:15798203
  4. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  5. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  6. [ + ] Wiemann S, et al. (2004) "From ORFeome to biology: a functional genomics pipeline." Genome Res. 14(10B):2136-2144. PMID:15489336
  7. [ + ] Arai A, et al. (2002) "STARS, a striated muscle activator of Rho signaling and serum response factor-dependent transcription." J Biol Chem. 277(27):24453-24459. PMID:11983702
  8. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  9. [ + ] Wiemann S, et al. (2001) "Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs." Genome Res. 11(3):422-435. PMID:11230166
  10. [ + ] Simpson JC, et al. (2000) "Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing." EMBO Rep. 1(3):287-292. PMID:11256614
  11. [ + ] Hartley JL, et al. (2000) "DNA cloning using in vitro site-specific recombination." Genome Res. 10(11):1788-1795. PMID:11076863