AASDH | GeneID:132949 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 132949 Official Symbol AASDH
Locus N/A Gene Type protein-coding
Synonyms ACSF4; LYS2; NRPS1098; NRPS998
Full Name aminoadipate-semialdehyde dehydrogenase
Description aminoadipate-semialdehyde dehydrogenase
Chromosome 4q12
Also Known As 2-aminoadipic 6-semialdehyde dehydrogenase; acyl-CoA synthetase family member 4; non-ribosomal peptide synthetase 1098; non-ribosomal peptide synthetase 998
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 71711

ID Symbol Protein Species
GeneID:34175 U26 NP_609230.2 Drosophila melanogaster
GeneID:132949 AASDH NP_861522.2 Homo sapiens
GeneID:231326 Aasdh NP_776126.1 Mus musculus
GeneID:364136 Aasdh XP_344231.2 Rattus norvegicus
GeneID:422744 AASDH XP_420697.2 Gallus gallus
GeneID:471237 AASDH XP_526619.2 Pan troglodytes
GeneID:482159 AASDH XP_539278.2 Canis lupus familiaris
GeneID:570338 si:dkeyp-117h8.3 XP_698902.2 Danio rerio
GeneID:782093 AASDH XP_001250589.1 Bos taurus
GeneID:833582 AT5G35930 NP_198442.2 Arabidopsis thaliana
GeneID:1279502 AgaP_AGAP010071 XP_319228.2 Anopheles gambiae
GeneID:4339893 Os06g0111600 NP_001056587.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab70709 AASDH antibody (ab70709); Mouse polyclonal to AASDH

Exon, Intron and UTRs

Exon, Intron and UTRs of AASDH Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AASDH Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016878 Function acid-thiol ligase activity
GO:0000036 Function acyl carrier activity
GO:0005524 Function ATP binding
GO:0048037 Function cofactor binding
GO:0016874 Function ligase activity
GO:0000166 Function nucleotide binding
GO:0006631 Process fatty acid metabolic process
GO:0006629 Process lipid metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_181806  UCSC Browser NP_861522

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000205214 MI0000060 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000205214 MI0000062 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000205214 MI0000063 hsa-let-7b* CUAUACAACCUACUGCCUUCCC
ENST00000205214 MI0000065 hsa-let-7d* CUAUACGACCUGCUGCCUUUCU
ENST00000205214 MI0000067 hsa-let-7f-1* CUAUACAAUCUAUUGCCUUCCC
ENST00000205214 MI0000068 hsa-let-7f-2* CUAUACAGUCUACUGUCUUUCC
ENST00000205214 MI0000448 hsa-miR-130a* UUCACAUUGUGCUACUGUCUGC
ENST00000205214 MI0000452 hsa-miR-135a* UAUAGGGAUUGGAGCCGUGGCG
ENST00000205214 MI0000083 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000205214 MI0000750 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000205214 MI0000084 hsa-miR-26b UUCAAGUAAUUCAGGAUAGGU
ENST00000205214 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENST00000205214 MI0000091 hsa-miR-33a* CAAUGUUUCCACAGUGCAUCAC
ENST00000205214 MI0000802 hsa-miR-340 UUAUAAAGCAAUGAGACUGAUU
ENST00000205214 MI0000788 hsa-miR-380 UAUGUAAUAUGGUCCACAUCUU
ENST00000205214 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENST00000205214 MI0003574 hsa-miR-568 AUGUAUAAAUGUAUACACAC
ENST00000205214 MI0003620 hsa-miR-607 GUUCAAAUCCAGAUCUAUAAC
ENST00000205214 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of AASDH mRNA
17557909

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 11677210, 15861022, 17681005, 17333356, 16919318, 16105132
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Watkins PA, et al. (2007) "Evidence for 26 distinct acyl-coenzyme A synthetase genes in the human genome." J Lipid Res. 48(12):2736-2750. PMID:17762044
  2. [ + ] Wang L, et al. (2005) "Cloning and characterization of a novel human homolog* of mouse U26, a putative PQQ-dependent AAS dehydrogenase." Mol Biol Rep. 32(1):47-53. PMID:15865210
  3. [ + ] Wellenreuther R, et al. (2004) "SMART amplification combined with cDNA size fractionation in order to obtain large full-length clones." BMC Genomics. 5(1):36. PMID:15198809
  4. [ + ] Kasahara T, et al. (2003) "Nutritional biochemistry: A new redox-cofactor vitamin for mammals." Nature. 422(6934):832. PMID:12712191
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Wiemann S, et al. (2001) "Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs." Genome Res. 11(3):422-435. PMID:11230166