AADAC | GeneID:13 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 13 Official Symbol AADAC
Locus N/A Gene Type protein-coding
Synonyms CES5A1; DAC
Full Name arylacetamide deacetylase (esterase)
Description arylacetamide deacetylase (esterase)
Chromosome 3q21.3-q25.2
Also Known As arylacetamide deacetylase
Summary Microsomal arylacetamide deacetylase competes against the activity of cytosolic arylamine N-acetyltransferase, which catalyzes one of the initial biotransformation pathways for arylamine and heterocyclic amine carcinogens [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37436

ID Symbol Protein Species
GeneID:13 AADAC NP_001077.2 Homo sapiens
GeneID:57300 Aadac NP_065413.1 Rattus norvegicus
GeneID:67758 Aadac NP_075872.1 Mus musculus
GeneID:425034 AADACL2 XP_422836.2 Gallus gallus
GeneID:460785 AADAC XP_001145851.1 Pan troglodytes
GeneID:477115 AADAC XP_534309.2 Canis lupus familiaris
GeneID:519557 AADAC NP_001069259.1 Bos taurus
GeneID:100148912 LOC100148912 XP_001923714.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab54694 AADAC antibody (ab54694); Mouse monoclonal to AADAC
2 abcam ab62176 AADAC antibody (ab62176); Rabbit polyclonal to AADAC
3 abnova H00000013-M01 AADAC monoclonal antibody (M01), clone 2E8; Mouse monoclonal antibody raised against a partial recombinant AADAC.
4 acris AP17069PU-N AADAC (C-term); antibody Ab
5 sigma HPA002911 Anti-AADAC antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of AADAC Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AADAC Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005783 Component endoplasmic reticulum
GO:0005789 Component endoplasmic reticulum membrane
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005792 Component microsome
GO:0004091 Function carboxylesterase activity
GO:0019213 Function deacetylase activity
GO:0016298 Function lipase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001086  UCSC Browser NP_001077

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000232892 MI0000060 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000232892 MI0000062 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000232892 MI0000063 hsa-let-7b* CUAUACAACCUACUGCCUUCCC
ENST00000232892 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000232892 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000232892 MI0000113 hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAG
ENST00000232892 MI0000734 hsa-miR-106b UAAAGUGCUGACAGUGCAGAU
ENST00000232892 MI0000448 hsa-miR-130a* UUCACAUUGUGCUACUGUCUGC
ENST00000232892 MI0000458 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENST00000232892 MI0000458 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENST00000232892 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENST00000232892 MI0000460 hsa-miR-144 UACAGUAUAGAUGAUGUACU
ENST00000232892 MI0000069 hsa-miR-15a* CAGGCCAUAUUGUGCUGCCUCA
ENST00000232892 MI0000115 hsa-miR-16-2* CCAAUAUUACUGUGCUGCUUUA
ENST00000232892 MI0000071 hsa-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENST00000232892 MI0001518 hsa-miR-18b UAAGGUGCAUCUAGUGCAGUUAG
ENST00000232892 MI0000489 hsa-miR-195* CCAAUAUUGGCUGUGCUGCUCC
ENST00000232892 MI0000076 hsa-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENST00000232892 MI0001519 hsa-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENST00000232892 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENST00000232892 MI0000293 hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA
ENST00000232892 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENST00000232892 MI0000740 hsa-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU
ENST00000232892 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000232892 MI0000298 hsa-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENST00000232892 MI0000299 hsa-miR-222 AGCUACAUCUGGCUACUGGGU
ENST00000232892 MI0000440 hsa-miR-27b* AGAGCUUAGCUGAUUGGUGAAC
ENST00000232892 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENST00000232892 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENST00000232892 MI0000735 hsa-miR-29c* UGACCGAUUUCUCCUGGUGUUC
ENST00000232892 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENST00000232892 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENST00000232892 MI0000091 hsa-miR-33a* CAAUGUUUCCACAGUGCAUCAC
ENST00000232892 MI0003646 hsa-miR-33b* CAGUGCCUCGGCAGUGCAGCCC
ENST00000232892 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000232892 MI0000777 hsa-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENST00000232892 MI0000787 hsa-miR-379 UGGUAGACUAUGGAACGUAGG
ENST00000232892 MI0000788 hsa-miR-380 UAUGUAAUAUGGUCCACAUCUU
ENST00000232892 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENST00000232892 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENST00000232892 MI0003530 hsa-miR-487b AAUCGUACAGGGUCAUCCACUU
ENST00000232892 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000232892 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000232892 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000232892 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000232892 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000232892 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000232892 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENST00000232892 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENST00000232892 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000232892 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENST00000232892 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENST00000232892 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000232892 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENST00000232892 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000232892 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENST00000232892 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENST00000232892 MI0003150 hsa-miR-526b* GAAAGUGCUUCCUUUUAGAGGC
ENST00000232892 MI0005539 hsa-miR-541* AAAGGAUUCUGCUGUCGGUCCCACU
ENST00000232892 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000232892 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000232892 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENST00000232892 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENST00000232892 MI0003583 hsa-miR-576-3p AAGAUGUGGAAAAAUUGGAAUC
ENST00000232892 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENST00000232892 MI0003587 hsa-miR-580 UUGAGAAUGAUGAAUCAUUAGG
ENST00000232892 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENST00000232892 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENST00000232892 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENST00000232892 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENST00000232892 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENST00000232892 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENST00000232892 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENST00000232892 MI0000263 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000232892 MI0000264 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000232892 MI0000265 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000232892 MI0005543 hsa-miR-708* CAACUAGACUGUGAGCUUCUAG
ENST00000232892 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENST00000232892 MI0000095 hsa-miR-93 CAAAGUGCUGUUCGUGCAGGUAG
ENST00000232892 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENST00000232892 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENST00000232892 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENST00000232892 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENST00000232892 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000232892 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000232892 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000232892 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENST00000232892 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENST00000232892 MI0004658 mmu-miR-690 AAAGGCUAGGCUCACAACCAAA
ENST00000232892 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG
ENST00000232892 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of AADAC mRNA
17562736
paricalcitol
  • [Phosphorus co-treated with paricalcitol] results in increased expression of AADAC mRNA
17715259
Phosphorus
  • [Phosphorus co-treated with paricalcitol] results in increased expression of AADAC mRNA
17715259
pirinixic acid
  • pirinixic acid results in increased expression of AADAC mRNA
17426115

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17562736, 14986274, 17522070, 16081117, 16177239, 15968718, 16227642
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Frick C, et al. (2004) "Appropriate function of 11beta-hydroxysteroid dehydrogenase type 1 in the endoplasmic reticulum lumen is dependent on its N-terminal region sharing similar topological determinants with 50-kDa esterase." J Biol Chem. 279(30):31131-31138. PMID:15152005
  5. [ + ] Saito S, et al. (2003) "Catalog of 680 variations among eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes in the Japanese population." J Hum Genet. 48(5):249-270. PMID:12721789
  6. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  7. [ + ] Trickett JI, et al. (2001) "Characterization of the rodent genes for arylacetamide deacetylase, a putative microsomal lipase, and evidence for transcriptional regulation." J Biol Chem. 276(43):39522-39532. PMID:11481320
  8. [ + ] Mziaut H, et al. (1999) "Targeting proteins to the lumen of endoplasmic reticulum using N-terminal domains of 11beta-hydroxysteroid dehydrogenase and the 50-kDa esterase." J Biol Chem. 274(20):14122-14129. PMID:10318829
  9. [ + ] Ozols J, et al. (1998) "Determination of lumenal orientation of microsomal 50-kDa esterase/N-deacetylase." Biochemistry. 37(28):10336-10344. PMID:9665742
  10. [ + ] Yamazaki K, et al. (1997) "Radiation hybrid mapping of human arylacetamide deacetylase (AADAC) locus to chromosome 3." Genomics. 44(2):248-250. PMID:9299245
  11. [ + ] Probst MR, et al. (1994) "Human liver arylacetamide deacetylase. Molecular cloning of a novel esterase involved in the metabolic activation of arylamine carcinogens with high sequence similarity to hormone-sensitive lipase." J Biol Chem. 269(34):21650-21656. PMID:8063807
  12. [ + ] Probst MR, et al. (1991) "Purification and characterization of a human liver arylacetamide deacetylase." Biochem Biophys Res Commun. 177(1):453-459. PMID:2043131