AADAC | GeneID:13 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 13 | Official Symbol | AADAC |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | CES5A1; DAC | ||
| Full Name | arylacetamide deacetylase (esterase) | ||
| Description | arylacetamide deacetylase (esterase) | ||
| Chromosome | 3q21.3-q25.2 | ||
| Also Known As | arylacetamide deacetylase | ||
| Summary | Microsomal arylacetamide deacetylase competes against the activity of cytosolic arylamine N-acetyltransferase, which catalyzes one of the initial biotransformation pathways for arylamine and heterocyclic amine carcinogens [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 37436
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:13 | AADAC | NP_001077.2 | Homo sapiens |
| GeneID:57300 | Aadac | NP_065413.1 | Rattus norvegicus |
| GeneID:67758 | Aadac | NP_075872.1 | Mus musculus |
| GeneID:425034 | AADACL2 | XP_422836.2 | Gallus gallus |
| GeneID:460785 | AADAC | XP_001145851.1 | Pan troglodytes |
| GeneID:477115 | AADAC | XP_534309.2 | Canis lupus familiaris |
| GeneID:519557 | AADAC | NP_001069259.1 | Bos taurus |
| GeneID:100148912 | LOC100148912 | XP_001923714.1 | Danio rerio |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab54694 | AADAC antibody (ab54694); Mouse monoclonal to AADAC |
| 2 | abcam | ab62176 | AADAC antibody (ab62176); Rabbit polyclonal to AADAC |
| 3 | abnova | H00000013-M01 | AADAC monoclonal antibody (M01), clone 2E8; Mouse monoclonal antibody raised against a partial recombinant AADAC. |
| 4 | acris | AP17069PU-N | AADAC (C-term); antibody Ab |
| 5 | sigma | HPA002911 | Anti-AADAC antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0005783 | Component | endoplasmic reticulum |
| GO:0005789 | Component | endoplasmic reticulum membrane |
| GO:0016021 | Component | integral to membrane |
| GO:0016020 | Component | membrane |
| GO:0005792 | Component | microsome |
| GO:0004091 | Function | carboxylesterase activity |
| GO:0019213 | Function | deacetylase activity |
| GO:0016298 | Function | lipase activity |
| GO:0008152 | Process | metabolic process |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000232892 | MI0000060 | hsa-let-7a* | CUAUACAAUCUACUGUCUUUC |
| ENST00000232892 | MI0000062 | hsa-let-7a* | CUAUACAAUCUACUGUCUUUC |
| ENST00000232892 | MI0000063 | hsa-let-7b* | CUAUACAACCUACUGCCUUCCC |
| ENST00000232892 | MI0000437 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUAU |
| ENST00000232892 | MI0000651 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUAU |
| ENST00000232892 | MI0000113 | hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAG |
| ENST00000232892 | MI0000734 | hsa-miR-106b | UAAAGUGCUGACAGUGCAGAU |
| ENST00000232892 | MI0000448 | hsa-miR-130a* | UUCACAUUGUGCUACUGUCUGC |
| ENST00000232892 | MI0000458 | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
| ENST00000232892 | MI0000458 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUACU |
| ENST00000232892 | MI0000459 | hsa-miR-143 | UGAGAUGAAGCACUGUAGCUC |
| ENST00000232892 | MI0000460 | hsa-miR-144 | UACAGUAUAGAUGAUGUACU |
| ENST00000232892 | MI0000069 | hsa-miR-15a* | CAGGCCAUAUUGUGCUGCCUCA |
| ENST00000232892 | MI0000115 | hsa-miR-16-2* | CCAAUAUUACUGUGCUGCUUUA |
| ENST00000232892 | MI0000071 | hsa-miR-17 | CAAAGUGCUUACAGUGCAGGUAG |
| ENST00000232892 | MI0001518 | hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUAG |
| ENST00000232892 | MI0000489 | hsa-miR-195* | CCAAUAUUGGCUGUGCUGCUCC |
| ENST00000232892 | MI0000076 | hsa-miR-20a | UAAAGUGCUUAUAGUGCAGGUAG |
| ENST00000232892 | MI0001519 | hsa-miR-20b | CAAAGUGCUCAUAGUGCAGGUAG |
| ENST00000232892 | MI0000292 | hsa-miR-216a | UAAUCUCAGCUGGCAACUGUGA |
| ENST00000232892 | MI0000293 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGA |
| ENST00000232892 | MI0000296 | hsa-miR-219-1-3p | AGAGUUGAGUCUGGACGUCCCG |
| ENST00000232892 | MI0000740 | hsa-miR-219-2-3p | AGAAUUGUGGCUGGACAUCUGU |
| ENST00000232892 | MI0000078 | hsa-miR-22 | AAGCUGCCAGUUGAAGAACUGU |
| ENST00000232892 | MI0000298 | hsa-miR-221 | AGCUACAUUGUCUGCUGGGUUUC |
| ENST00000232892 | MI0000299 | hsa-miR-222 | AGCUACAUCUGGCUACUGGGU |
| ENST00000232892 | MI0000440 | hsa-miR-27b* | AGAGCUUAGCUGAUUGGUGAAC |
| ENST00000232892 | MI0000086 | hsa-miR-28-3p | CACUAGAUUGUGAGCUCCUGGA |
| ENST00000232892 | MI0000744 | hsa-miR-299-3p | UAUGUGGGAUGGUAAACCGCUU |
| ENST00000232892 | MI0000735 | hsa-miR-29c* | UGACCGAUUUCUCCUGGUGUUC |
| ENST00000232892 | MI0005525 | hsa-miR-300 | UAUACAAGGGCAGACUCUCUCU |
| ENST00000232892 | MI0000091 | hsa-miR-33a | GUGCAUUGUAGUUGCAUUGCA |
| ENST00000232892 | MI0000091 | hsa-miR-33a* | CAAUGUUUCCACAGUGCAUCAC |
| ENST00000232892 | MI0003646 | hsa-miR-33b* | CAGUGCCUCGGCAGUGCAGCCC |
| ENST00000232892 | MI0000743 | hsa-miR-34c-5p | AGGCAGUGUAGUUAGCUGAUUGC |
| ENST00000232892 | MI0000777 | hsa-miR-369-5p | AGAUCGACCGUGUUAUAUUCGC |
| ENST00000232892 | MI0000787 | hsa-miR-379 | UGGUAGACUAUGGAACGUAGG |
| ENST00000232892 | MI0000788 | hsa-miR-380 | UAUGUAAUAUGGUCCACAUCUU |
| ENST00000232892 | MI0000789 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| ENST00000232892 | MI0003820 | hsa-miR-454 | UAGUGCAAUAUUGCUUAUAGGGU |
| ENST00000232892 | MI0003530 | hsa-miR-487b | AAUCGUACAGGGUCAUCCACUU |
| ENST00000232892 | MI0003144 | hsa-miR-515-3p | GAGUGCCUUCUUUUGGAGCGUU |
| ENST00000232892 | MI0003147 | hsa-miR-515-3p | GAGUGCCUUCUUUUGGAGCGUU |
| ENST00000232892 | MI0003178 | hsa-miR-519a | AAAGUGCAUCCUUUUAGAGUGU |
| ENST00000232892 | MI0003182 | hsa-miR-519a | AAAGUGCAUCCUUUUAGAGUGU |
| ENST00000232892 | MI0003151 | hsa-miR-519b-3p | AAAGUGCAUCCUUUUAGAGGUU |
| ENST00000232892 | MI0003148 | hsa-miR-519c-3p | AAAGUGCAUCUUUUUAGAGGAU |
| ENST00000232892 | MI0003162 | hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUG |
| ENST00000232892 | MI0003145 | hsa-miR-519e | AAGUGCCUCCUUUUAGAGUGUU |
| ENST00000232892 | MI0003149 | hsa-miR-520a-3p | AAAGUGCUUCCCUUUGGACUGU |
| ENST00000232892 | MI0003155 | hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG |
| ENST00000232892 | MI0003158 | hsa-miR-520c-3p | AAAGUGCUUCCUUUUAGAGGGU |
| ENST00000232892 | MI0003164 | hsa-miR-520d-3p | AAAGUGCUUCUCUUUGGUGGGU |
| ENST00000232892 | MI0003143 | hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG |
| ENST00000232892 | MI0003146 | hsa-miR-520f | AAGUGCUUCCUUUUAGAGGGUU |
| ENST00000232892 | MI0003166 | hsa-miR-520g | ACAAAGUGCUUCCCUUUAGAGUGU |
| ENST00000232892 | MI0003175 | hsa-miR-520h | ACAAAGUGCUUCCCUUUAGAGU |
| ENST00000232892 | MI0003150 | hsa-miR-526b* | GAAAGUGCUUCCUUUUAGAGGC |
| ENST00000232892 | MI0005539 | hsa-miR-541* | AAAGGAUUCUGCUGUCGGUCCCACU |
| ENST00000232892 | MI0003600 | hsa-miR-550 | AGUGCCUGAGGGAGUAAGAGCCC |
| ENST00000232892 | MI0003601 | hsa-miR-550 | AGUGCCUGAGGGAGUAAGAGCCC |
| ENST00000232892 | MI0003565 | hsa-miR-559 | UAAAGUAAAUAUGCACCAAAA |
| ENST00000232892 | MI0003580 | hsa-miR-573 | CUGAAGUGAUGUGUAACUGAUCAG |
| ENST00000232892 | MI0003583 | hsa-miR-576-3p | AAGAUGUGGAAAAAUUGGAAUC |
| ENST00000232892 | MI0003583 | hsa-miR-576-5p | AUUCUAAUUUCUCCACGUCUUU |
| ENST00000232892 | MI0003587 | hsa-miR-580 | UUGAGAAUGAUGAAUCAUUAGG |
| ENST00000232892 | MI0003602 | hsa-miR-590-3p | UAAUUUUAUGUAUAAGCUAGU |
| ENST00000232892 | MI0003602 | hsa-miR-590-5p | GAGCUUAUUCAUAAAAGUGCAG |
| ENST00000232892 | MI0003618 | hsa-miR-605 | UAAAUCCCAUGGUGCCUUCUCCU |
| ENST00000232892 | MI0003648 | hsa-miR-633 | CUAAUAGUAUCUACCACAAUAAA |
| ENST00000232892 | MI0003658 | hsa-miR-643 | ACUUGUAUGCUAGCUCAGGUAG |
| ENST00000232892 | MI0003663 | hsa-miR-648 | AAGUGUGCAGGGCACUGGU |
| ENST00000232892 | MI0003666 | hsa-miR-651 | UUUAGGAUAAGCUUGACUUUUG |
| ENST00000232892 | MI0000263 | hsa-miR-7 | UGGAAGACUAGUGAUUUUGUUGU |
| ENST00000232892 | MI0000264 | hsa-miR-7 | UGGAAGACUAGUGAUUUUGUUGU |
| ENST00000232892 | MI0000265 | hsa-miR-7 | UGGAAGACUAGUGAUUUUGUUGU |
| ENST00000232892 | MI0005543 | hsa-miR-708* | CAACUAGACUGUGAGCUUCUAG |
| ENST00000232892 | MI0005534 | hsa-miR-891b | UGCAACUUACCUGAGUCAUUGA |
| ENST00000232892 | MI0000095 | hsa-miR-93 | CAAAGUGCUGUUCGUGCAGGUAG |
| ENST00000232892 | MI0000388 | mmu-miR-290-3p | AAAGUGCCGCCUAGUUUUAAGCCC |
| ENST00000232892 | MI0000390 | mmu-miR-292-3p | AAAGUGCCGCCAGGUUUUGAGUGU |
| ENST00000232892 | MI0000640 | mmu-miR-350 | UUCACAAAGCCCAUACACUUUC |
| ENST00000232892 | MI0002398 | mmu-miR-463 | UGAUAGACACCAUAUAAGGUAG |
| ENST00000232892 | MI0005507 | mmu-miR-466f-5p | UACGUGUGUGUGCAUGUGCAUG |
| ENST00000232892 | MI0005508 | mmu-miR-466f-5p | UACGUGUGUGUGCAUGUGCAUG |
| ENST00000232892 | MI0005509 | mmu-miR-466f-5p | UACGUGUGUGUGCAUGUGCAUG |
| ENST00000232892 | MI0002402 | mmu-miR-467a | UAAGUGCCUGCAUGUAUAUGCG |
| ENST00000232892 | MI0004671 | mmu-miR-467b | GUAAGUGCCUGCAUGUAUAUG |
| ENST00000232892 | MI0004658 | mmu-miR-690 | AAAGGCUAGGCUCACAACCAAA |
| ENST00000232892 | MI0004694 | mmu-miR-710 | CCAAGUCUUGGGGAGAGUUGAG |
| ENST00000232892 | MI0004310 | mmu-miR-764-5p | GGUGCUCACAUGUCCUCCU |
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| Acetaminophen | |
|
|
| paricalcitol | |
|
|
| Phosphorus | |
|
|
| pirinixic acid | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Disease Name | Relationship | PubMed |
|---|---|---|
| Edema | inferred via pirinixic acid | 12083418 |
| Liver Neoplasms | inferred via pirinixic acid | 15890375 |
| Hepatitis, Toxic | inferred via Acetaminophen | 2444490, 17562736, 14986274, 17522070, 16081117, 16177239, 15968718, 16227642 |
| Hyperalgesia | inferred via Acetaminophen | 16870215 |
| Liver Failure, Acute | inferred via Acetaminophen | 16871587, 17185352 |
| Pain | inferred via Acetaminophen | 16870215 |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046 - [
] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348 - [
] Frick C, et al. (2004) "Appropriate function of 11beta-hydroxysteroid dehydrogenase type 1 in the endoplasmic reticulum lumen is dependent on its N-terminal region sharing similar topological determinants with 50-kDa esterase." J Biol Chem. 279(30):31131-31138. PMID:15152005 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Saito S, et al. (2003) "Catalog of 680 variations among eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes in the Japanese population." J Hum Genet. 48(5):249-270. PMID:12721789 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Trickett JI, et al. (2001) "Characterization of the rodent genes for arylacetamide deacetylase, a putative microsomal lipase, and evidence for transcriptional regulation." J Biol Chem. 276(43):39522-39532. PMID:11481320 - [
] Mziaut H, et al. (1999) "Targeting proteins to the lumen of endoplasmic reticulum using N-terminal domains of 11beta-hydroxysteroid dehydrogenase and the 50-kDa esterase." J Biol Chem. 274(20):14122-14129. PMID:10318829 - [
] Ozols J, et al. (1998) "Determination of lumenal orientation of microsomal 50-kDa esterase/N-deacetylase." Biochemistry. 37(28):10336-10344. PMID:9665742 - [
] Yamazaki K, et al. (1997) "Radiation hybrid mapping of human arylacetamide deacetylase (AADAC) locus to chromosome 3." Genomics. 44(2):248-250. PMID:9299245 - [
] Probst MR, et al. (1994) "Human liver arylacetamide deacetylase. Molecular cloning of a novel esterase involved in the metabolic activation of arylamine carcinogens with high sequence similarity to hormone-sensitive lipase." J Biol Chem. 269(34):21650-21656. PMID:8063807 - [
] Probst MR, et al. (1991) "Purification and characterization of a human liver arylacetamide deacetylase." Biochem Biophys Res Commun. 177(1):453-459. PMID:2043131
With dense single-nucleotide polymorphism (SNP) maps for 199 drug-related genes, we examined associations between 4190 SNPs and 38 commonly measured quantitative traits using data from 752 healthy Japanese subjects. On analysis, we observed a strong association between five SNPs within the uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1) gene and serum total bilirubin levels (minimum P-value in Mann-Whitney test=1.82 x 10(10)). UGT1A1 catalyzes the conjugation of bilirubin with glucuronic acid, thus enhancing bilirubin elimination. This enzyme is known to play an important role in the variation of serum bilirubin levels. The five SNPs, including a nonsynonymous SNP-rs4148323 (211G>A or G71R variant allele known as UGT1A1*6)-showed strong linkage disequilibrium with each other. No other genes were clearly associated with serum total bilirubin levels. Results of linear multiple regression analysis on serum total bilirubin levels followed by analysis of variance showed that at least 13% of the variance in serum total bilirubin levels could be explained by three haplotype-tagging SNPs in the UGT1A1 gene.Journal of Human Genetics (2009) 54, 317-323; doi:10.1038/jhg.2009.31; published online 3 April 2009.
Information on protein localization on the subcellular level is important to map and characterize the proteome and to better understand cellular functions of proteins. Here we report on a pilot study of 466 proteins in three human cell lines aimed to allow large scale confocal microscopy analysis using protein-specific antibodies. Approximately 3000 high resolution images were generated, and more than 80% of the analyzed proteins could be classified in one or multiple subcellular compartment(s). The localizations of the proteins showed, in many cases, good agreement with the Gene Ontology localization prediction model. This is the first large scale antibody-based study to localize proteins into subcellular compartments using antibodies and confocal microscopy. The results suggest that this approach might be a valuable tool in conjunction with predictive models for protein localization.
By interconverting glucocorticoids, 11beta-hydroxysteroid dehydrogenase type 1 (11beta-HSD1) exerts an important pre-receptor function and is currently considered a promising therapeutic target. In addition, 11beta-HSD1 plays a potential role in 7-ketocholesterol metabolism. Here we investigated the role of the N-terminal region on enzymatic activity and addressed the relevance of 11beta-HSD1 orientation into the endoplasmic reticulum (ER) lumen. Previous studies revealed that the luminal orientation of 11beta-HSD1 and 50-kDa esterase/arylacetamide deacetylase (E3) is determined by their highly similar N-terminal transmembrane domains. Substitution of Lys(5) by Ser in 11beta-HSD1, but not of the analogous Lys(4) by Ile in E3, led to an inverted topology in the ER membrane, indicating the existence of a second topological determinant. Here we identified Glu(25)/Glu(26) in 11beta-HSD1 and Asp(25) in E3 as the second determinant for luminal orientation. Our results suggest that the exact location of specific residues rather than net charge distribution on either side of the helix is critical for membrane topology. Analysis of charged residues in the N-terminal domain revealed an essential role of Lys(35)/Lys(36) and Glu(25)/Glu(26) on enzymatic activity, suggesting that these residues are responsible for the observed stabilizing effect of the N-terminal membrane anchor on the catalytic domain of 11beta-HSD1. Moreover, activity measurements in intact cells expressing wild-type 11beta-HSD1, facing the ER lumen, or mutant K5S/K6S, facing the cytoplasm, revealed that the luminal orientation is essential for efficient oxidation of cortisol. Furthermore, we demonstrate that 11beta-HSD1, but not mutant K5S/K6S with cytoplasmic orientation, catalyzes the oxoreduction of 7-ketocholesterol. 11beta-HSD1 and E3 constructs with cytosolic orientation of their catalytic moiety should prove useful in future studies addressing the physiological function of these proteins.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
We screened DNAs from 48 Japanese individuals for single-nucleotide polymorphisms (SNPs) in eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes by directly sequencing the relevant genomic regions in their entirety except for repetitive elements. This approach identified 607 SNPs and 73 insertion/deletion polymorphisms among the 19 genes examined. Of the 607 SNPs, 284 were identified in CYP genes, 302 in esterase genes, and 21 in the other two genes ( GGT1, and TGM1); overall, 37 SNPs were located in 5' flanking regions, 496 in introns, 55 in exons, and 19 in 3' flanking regions. These variants should contribute to studies designed to investigate possible correlations between genotypes and phenotypes of disease susceptibility or responsiveness to drug therapy.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
In the current study, we have determined the cDNA and the genomic sequences of the arylacetamide deacetylase (AADA) gene in mice and rats. The AADA genes in the rat and mouse consist of five exons and have 2.4 kilobases of homologous promoter sequence upstream of the initiating ATG codon. AADA mRNA is expressed in hepatocytes, intestinal mucosal cells (probably enterocytes), the pancreas and also the adrenal gland. In mice, there is a diurnal rhythm in hepatic AADA mRNA concentration, with a maximum 10 h into the light (post-absorptive) phase. This diurnal regulation is attenuated in peroxisome proliferator-activated receptor alpha knockout mice. Intestinal but not hepatic AADA mRNA was increased following oral administration of the fibrate, Wy-14,643. The homology of AADA with hormone-sensitive lipase and the tissue distribution of AADA are consistent with the view that AADA plays a role in promoting the mobilization of lipids from intracellular stores and in the liver for assembling VLDL. This hypothesis is supported by parallel changes in AADA gene expression in animals with insulin-deficient diabetes and following treatment with orotic acid.
Previous studies identified two intrinsic endoplasmic reticulum (ER) proteins, 11beta-hydroxysteroid dehydrogenase, isozyme 1 (11beta-HSD) and the 50-kDa esterase (E3), sharing some amino acid sequence motifs in their N-terminal transmembrane (TM) domains. Both are type II membrane proteins with the C terminus projecting into the lumen of the ER. This finding implied that the N-terminal TM domains of 11beta-HSD and E3 may constitute a lumenal targeting signal (LTS). To investigate this hypothesis we created chimeric fusions using the putative targeting sequences and the reporter gene, Aequorea victoria green fluorescent protein. Transfected COS cells expressing LTS-green fluorescent protein chimeras were examined by fluorescent microscopy and electron microscopic immunogold labeling. The orientation of expressed chimeras was established by immunocytofluorescent staining of selectively permeabilized COS cells. In addition, protease protection assays of membranes in the presence and absence of detergents was used to confirm lumenal or the cytosolic orientation of the constructed chimeras. To investigate the general applicability of the proposed LTS, we fused the N terminus of E3 to the N terminus of the NADH-cytochrome b5 reductase lacking the myristoyl group and N-terminal 30-residue membrane anchor. The orientation of the cytochrome b5 reductase was reversed, from cytosolic to lumenal projection of the active domain. These observations establish that an amino acid sequence consisting of short basic or neutral residues at the N terminus, followed by a specific array of hydrophobic residues terminating with acidic residues, is sufficient for lumenal targeting of single-pass proteins that are structurally and functionally unrelated.
The amino acid arrangements responsible for the insertion and specific lumenal orientation of proteins having an uncleaved signal-peptide-like anchor are poorly understood. A 50-kDa protein having a hydrophobic N-terminus similar to the lumenal glycoprotein 11beta-hydroxysteroid dehydrogenase [Ozols, J. (1995) J. Biol. Chem. 270, 2305-2312] was identified in detergent-solubilized microsomes. The posttranslational modifications and the membrane orientation of the 50-kDa protein were investigated using the approaches of protein structure analysis. Sequence analysis of the entire 50-kDa protein showed a lack of structural relatedness to the steroid dehydrogenase beyond the membrane binding segment. Structure analysis of peptides revealed that carbohydrate is attached at Asn-77 and Asn-281, implying that these sites of the 50-kDa protein are oriented toward the lumenal side of the endoplasmic membrane (ER). Specific enzymatic deglycosylation on the intact protein identified the two glycans as high mannose carbohydrate rather than of the complex type, suggesting that the protein had not undergone further trafficking steps beyond the lumen of ER. Chemical modification of cysteinyl residues showed a lack of free thiols in the intact protein. Peptide mapping identified one disulfide bond between Cys-115 and -340 further restricting the bulk of the protein to the lumenal compartment. Proteolysis of intact and solubilized microsomes showed that the 50-kDa protein is resistant to fragmentation at the conditions which led to the removal of the membranous segments from cytochrome b5 and the NADH-cytochrome b5 reductase. The proposed model of the 50-kDa protein predicts one transmembrane segment at the N-terminus, flanked by positively charged residues on the cytosolic surface and negatively charged residues on the lumenal side of the hydrophobic domain, with most of the polypeptide projecting into the lumen of the ER. The stated similarities in the topology between 11beta-steroid dehydrogenase and 50-kDa protein envision their transmembrane segment consisting of a basic residue(s) followed by an array of some 17 hydrophobic residues containing the Ala-Tyr-Tyr-X-Tyr cluster, where X represents a hydrophobic amino acid, which terminates with acidic residues. It is proposed here that such a motif may constitute a lumenal targeting signal for a set of single-membrane-spanning proteins that are otherwise structurally and functionally unrelated.
Microsomal arylacetamide deacetylase (DAC) competes against the activity of cytosolic arylamine N-acetyltransferase, which catalyzes one of the initial biotransformation pathways for arylamine and heterocyclic amine carcinogens in many species and tissues. Activity determination and immunoblot analysis of DAC in human target tissues for arylamine carcinogens revealed that in extrahepatic tissues, additional enzymes are responsible for any deacetylation activity, whereas a single enzyme predominantly catalyzes this hydrolytic reaction in liver. We isolated and characterized a full-length cDNA from a human liver lambda gt11 library. This clone encodes an open reading frame of 400 amino acids with a deduced molecular mass of 45.7 kDa and contains two putative glycosylation sites. The 3'-untranslated region contains two putative polyadenylation signals. The cDNA was confirmed to be that for DAC in tryptic peptides from the purified human liver protein. Highest sequence similarity of DAC was found in a series of prokaryotic esterases encompassing the putative active site. Two extended regions of significant sequence homology with hormone-sensitive lipase and with lipase 2 from Moraxella TA144 were identified, whereas similarity to carboxyl esterases was restricted to the region encompassing the putative active site, indicating that DAC should be classified as esterase. This cDNA provides an important tool to study deacetylation and its effects on the metabolic activation of arylamine and heterocyclic amine carcinogens.
Arylacetamide deacetylation is an important enzyme activity in the metabolic activation of arylamine substrates to ultimate carcinogens, best described as a carboxylesterase/amidase type of reaction. A 7-fold variation in the Vmax of 2-acetylaminofluorene deacetylation in 24 human livers was observed. An acetylaminofluorene deacetylase was purified 90 fold from human liver microsomes by PEG-fractionation, anion exchange and hydrophobic interaction chromatography. The purified 45kD protein showed no amino acid sequence homology to other carboxylesterases, neither in its N-terminus nor in tryptic peptides. Antibodies raised against the deacetylase recognized the protein with high specificity. This report thus describes the first arylacetamide deacetylase in human liver.

