A3GALT2 | GeneID:127550 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 127550 Official Symbol A3GALT2
Locus RP11-415J8.2 Gene Type protein-coding
Synonyms IGBS3S
Full Name alpha 1,3-galactosyltransferase 2
Description alpha 1,3-galactosyltransferase 2
Chromosome 1p35.1
Also Known As iGb3 synthase; isoglobotriaosylceramide synthase
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 16326

ID Symbol Protein Species
GeneID:127550 A3GALT2 NP_001073907.1 Homo sapiens
GeneID:171553 A3galt2 NP_612533.1 Rattus norvegicus
GeneID:215493 A3galt2 NP_001009819.1 Mus musculus
GeneID:487298 A3GALT2 XP_544424.2 Canis lupus familiaris

Exon, Intron and UTRs

Exon, Intron and UTRs of A3GALT2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of A3GALT2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005794 Component Golgi apparatus
GO:0016020 Component membrane
GO:0030145 Function manganese ion binding
GO:0046872 Function metal ion binding
GO:0047276 Function N-acetyllactosaminide 3-alpha-galactosyltransferase activity
GO:0016758 Function transferase activity, transferring hexosyl groups
GO:0005975 Process carbohydrate metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001080438  UCSC Browser NP_001073907

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000330379 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENST00000330379 MI0000472 hsa-miR-127-3p UCGGAUCCGUCUGAGCUUGGCU
ENST00000330379 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000330379 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000330379 MI0000809 hsa-miR-151-5p UCGAGGAGCUCACAGUCUAGU
ENST00000330379 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENST00000330379 MI0000085 hsa-miR-27a UUCACAGUGGCUAAGUUCCGC
ENST00000330379 MI0000440 hsa-miR-27b UUCACAGUGGCUAAGUUCUGC
ENST00000330379 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENST00000330379 MI0000805 hsa-miR-342-5p AGGGGUGCUAUCUGUGAUUGA
ENST00000330379 MI0000825 hsa-miR-345 GCUGACUCCUAGUCCAGGGCUC
ENST00000330379 MI0003123 hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC
ENST00000330379 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENST00000330379 MI0003183 hsa-miR-499-3p AACAUCACAGCAAGUCUGUGCU
ENST00000330379 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENST00000330379 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000330379 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000330379 MI0003145 hsa-miR-519e* UUCUCCAAAAGGGAGCACUUUC
ENST00000330379 MI0003205 hsa-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENST00000330379 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENST00000330379 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENST00000330379 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENST00000330379 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENST00000330379 MI0000095 hsa-miR-93* ACUGCUGAGCUAGCACUUCCCG
ENST00000330379 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENST00000330379 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Flavonoids
  • Flavonoids results in increased expression of A3GALT2 mRNA
18035473

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Inflammation inferred via Flavonoids 17296493

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Christiansen D, et al. (2008) "Humans lack iGb3 due to the absence of functional iGb3-synthase: implications for NKT cell development and transplantation." PLoS Biol. 6(7):e172. PMID:18630988
  2. [ + ] Keusch JJ, et al. (2000) "Expression cloning of a new member of the ABO blood group glycosyltransferases, iGb3 synthase, that directs the synthesis of isoglobo-glycosphingolipids." J Biol Chem. 275(33):25308-25314. PMID:10854427