AADACL3 | GeneID:126767 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 126767 Official Symbol AADACL3
Locus RP11-474O21.3 Gene Type protein-coding
Synonyms
Full Name arylacetamide deacetylase-like 3
Description arylacetamide deacetylase-like 3
Chromosome 1p36.21
Also Known As OTTHUMP00000001868; OTTHUMP00000001869
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 28426

ID Symbol Protein Species
GeneID:126767 AADACL3 NP_001096640.1 Homo sapiens
GeneID:230883 Aadacl3 XP_144109.1 Mus musculus
GeneID:313686 Aadacl3 XP_233636.4 Rattus norvegicus
GeneID:457970 AADACL3 XP_514407.2 Pan troglodytes
GeneID:487435 AADACL3 XP_544560.2 Canis lupus familiaris
GeneID:530613 AADACL3 XP_609088.2 Bos taurus

Exon, Intron and UTRs

Exon, Intron and UTRs of AADACL3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AADACL3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016787 Function hydrolase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001103169  UCSC Browser NP_001096639
2 NM_001103170  UCSC Browser NP_001096640

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000359318 MI0000090 hsa-miR-32 UAUUGCACAUUACUAAGUUGCA
ENST00000359318 MI0000268 hsa-miR-34a* CAAUCAGCAAGUAUACUGCCCU
ENST00000359318 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000359318 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000359318 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Gregory SG, et al. (2006) "The DNA sequence and biological annotation of human chromosome 1." Nature. 441(7091):315-321. PMID:16710414