ACER1 | GeneID:125981 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 125981 Official Symbol ACER1
Locus N/A Gene Type protein-coding
Synonyms ASAH3; MGC138327; MGC138329
Full Name alkaline ceramidase 1
Description alkaline ceramidase 1
Chromosome 19p13.3
Also Known As N-acylsphingosine amidohydrolase (alkaline ceramidase) 3
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 15853

ID Symbol Protein Species
GeneID:125981 ASAH3 NP_597999.1 Homo sapiens
GeneID:171168 Asah3 NP_783858.1 Mus musculus
GeneID:301118 Asah3 XP_236790.3 Rattus norvegicus
GeneID:420088 ASAH3 XP_418208.2 Gallus gallus
GeneID:468681 ASAH3 XP_524068.2 Pan troglodytes
GeneID:518021 ASAH3 XP_596203.2 Bos taurus
GeneID:550266 zgc:110285 NP_001017603.1 Danio rerio
GeneID:611739 ASAH3 XP_854540.1 Canis lupus familiaris

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab55823 ASAH3 antibody (ab55823); Rabbit polyclonal to ASAH3
2 scbt ASAH3 ASAH3 Antibody / ASAH3 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACER1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACER1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005783 Component endoplasmic reticulum
GO:0005789 Component endoplasmic reticulum membrane
GO:0000139 Component Golgi membrane
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0017040 Function ceramidase activity
GO:0016787 Function hydrolase activity
GO:0046514 Process ceramide catabolic process
GO:0019216 Process regulation of lipid metabolic process
GO:0006665 Process sphingolipid metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_133492  UCSC Browser NP_597999

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000301452 MI0000734 hsa-miR-106b UAAAGUGCUGACAGUGCAGAU
ENST00000301452 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENST00000301452 MI0000480 hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENST00000301452 MI0001519 hsa-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENST00000301452 MI0005569 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA
ENST00000301452 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000301452 MI0000440 hsa-miR-27b UUCACAGUGGCUAAGUUCUGC
ENST00000301452 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENST00000301452 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENST00000301452 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENST00000301452 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENST00000301452 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENST00000301452 MI0000767 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000301452 MI0000769 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000301452 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENST00000301452 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENST00000301452 MI0000787 hsa-miR-379* UAUGUAACAUGGUCCACUAACU
ENST00000301452 MI0000790 hsa-miR-382 GAAGUUGUUCGUGGUGGAUUCG
ENST00000301452 MI0003675 hsa-miR-411* UAUGUAACACGGUCCACUAACC
ENST00000301452 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000301452 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENST00000301452 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENST00000301452 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENST00000301452 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000301452 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000301452 MI0005116 hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG
ENST00000301452 MI0005118 hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA
ENST00000301452 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENST00000301452 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENST00000301452 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENST00000301452 MI0000095 hsa-miR-93 CAAAGUGCUGUUCGUGCAGGUAG
ENST00000301452 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENST00000301452 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENST00000301452 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENST00000301452 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG
ENST00000301452 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ASAH3 mRNA
17562736

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 16177239, 14986274, 17562736, 16081117, 16227642, 15968718
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sun W, et al. (2008) "Upregulation of the human alkaline ceramidase 1 and acid ceramidase mediates calcium-induced differentiation of epidermal keratinocytes." J Invest Dermatol. 128(2):389-397. PMID:17713573
  2. [ + ] Toulza E, et al. (2007) "Large-scale identification of human genes implicated in epidermal barrier function." Genome Biol. 8(6):R107. PMID:17562024
  3. [ + ] Houben E, et al. (2006) "Differentiation-associated expression of ceramidase isoforms in cultured keratinocytes and epidermis." J Lipid Res. 47(5):1063-1070. PMID:16477081
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Mao C, et al. (2003) "Cloning and characterization of a mouse endoplasmic reticulum alkaline ceramidase: an enzyme that preferentially regulates metabolism of very long chain ceramides." J Biol Chem. 278(33):31184-31191. PMID:12783875
  6. [ + ] Ito M, et al. (2002) "[Molecular evolution of neutral ceramidase: signalling molecule and virulence factor]" Tanpakushitsu Kakusan Koso. 47(4 Suppl):455-462. PMID:11915342
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932