ABCC2 | GeneID:1244 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 1244 Official Symbol ABCC2
Locus N/A Gene Type protein-coding
Synonyms ABC30; CMOAT; DJS; KIAA1010; MRP2; cMRP
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Chromosome 10q24
Also Known As OTTHUMP00000020267; canalicular multispecific organic anion transporter
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein is expressed in the canalicular (apical) part of the hepatocyte and functions in biliary transport. Substrates include anticancer drugs such as vinblastine; therefore, this protein appears to contribute to drug resistance in mammalian cells. Several different mutations in this gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68052

ID Symbol Protein Species
GeneID:1244 ABCC2 NP_000383.1 Homo sapiens
GeneID:12780 Abcc2 NP_038834.2 Mus musculus
GeneID:393561 abcc2 NP_956883.1 Danio rerio
GeneID:403632 ABCC2 NP_001003081.1 Canis lupus familiaris
GeneID:423828 ABCC2 XP_421698.2 Gallus gallus
GeneID:450670 ABCC2 XP_507976.2 Pan troglodytes
GeneID:520925 ABCC2 XP_599177.3 Bos taurus
GeneID:818031 ATMRP2 NP_181013.1 Arabidopsis thaliana
GeneID:839920 ATMRP1 NP_001031116.1 Arabidopsis thaliana
GeneID:4337027 Os04g0620000 NP_001053904.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab3373 MRP2 antibody [M2 III-6] (ab3373); Mouse monoclonal [M2 III-6] to MRP2
2 abcam ab50213 MRP2 antibody - Carboxyterminal end (ab50213); Rabbit polyclonal to MRP2 - Carboxyterminal end
3 abcam ab3372 MRP2 antibody [M2I-4] (ab3372); Mouse monoclonal [M2I-4] to MRP2
4 abcam ab24106 MRP2 antibody [M2II-12] (ab24106); Mouse monoclonal [M2II-12] to MRP2
5 abcam ab15603 MRP2 antibody [M2III-5] (ab15603); Mouse monoclonal [M2III-5] to MRP2
6 abnova H00001244-M01 ABCC2 monoclonal antibody (M01), clone 1C5; Mouse monoclonal antibody raised against a partial recombinant ABCC2.
7 abnova H00001244-M01A ABCC2 monoclonal antibody (M01), clone 1C5; Mouse monoclonal antibody raised against a partial recombinant ABCC2.
8 scbt ABCC2 ABCC2 Antibody / ABCC2 Antibodies;
9 sigma M8316 Anti-MRP2 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCC2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCC2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016324 Component apical plasma membrane
GO:0005887 Component integral to plasma membrane
GO:0046581 Component intercellular canaliculus
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0008514 Function organic anion transmembrane transporter activity
GO:0005515 Function protein binding
GO:0005215 Function transporter activity
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000392  UCSC Browser NP_000383 Q92887   B2RMT8  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000370449 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000370449 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000370449 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000370449 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000370449 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000370449 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000370449 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000370449 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000370449 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000370449 MI0000433 hsa-let-7g UGAGGUAGUAGUUUGUACAGUU
ENST00000370449 MI0000434 hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENST00000370449 MI0000456 hsa-miR-140-5p CAGUGGUUUUACCCUAUGGUAG
ENST00000370449 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000370449 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000370449 MI0000681 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU
ENST00000370449 MI0000070 hsa-miR-16-1* CCAGUAUUAACUGUGCUGCUGA
ENST00000370449 MI0000115 hsa-miR-16-2* CCAAUAUUACUGUGCUGCUUUA
ENST00000370449 MI0000072 hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUAG
ENST00000370449 MI0000489 hsa-miR-195* CCAAUAUUGGCUGUGCUGCUCC
ENST00000370449 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000370449 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENST00000370449 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENST00000370449 MI0000083 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000370449 MI0000750 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000370449 MI0000084 hsa-miR-26b UUCAAGUAAUUCAGGAUAGGU
ENST00000370449 MI0005775 hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG
ENST00000370449 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENST00000370449 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000370449 MI0000802 hsa-miR-340 UUAUAAAGCAAUGAGACUGAUU
ENST00000370449 MI0000784 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000370449 MI0003529 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000370449 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENST00000370449 MI0000787 hsa-miR-379 UGGUAGACUAUGGAACGUAGG
ENST00000370449 MI0000788 hsa-miR-380 UAUGUAAUAUGGUCCACAUCUU
ENST00000370449 MI0001727 hsa-miR-453 AGGUUGUCCGUGGUGAGUUCGCA
ENST00000370449 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC
ENST00000370449 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENST00000370449 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENST00000370449 MI0003125 hsa-miR-490-5p CCAUGGAUCUCCAGGUGGGU
ENST00000370449 MI0003185 hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU
ENST00000370449 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENST00000370449 MI0003514 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENST00000370449 MI0003593 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000370449 MI0003598 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000370449 MI0003612 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000370449 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENST00000370449 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENST00000370449 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENST00000370449 MI0003587 hsa-miR-580 UUGAGAAUGAUGAAUCAUUAGG
ENST00000370449 MI0003622 hsa-miR-609 AGGGUGUUUCUCUCAUCUCU
ENST00000370449 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENST00000370449 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENST00000370449 MI0003644 hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU
ENST00000370449 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENST00000370449 MI0000100 hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENST00000370449 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENST00000370449 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000370449 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000370449 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000370449 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000370449 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000370449 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000370449 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENST00000370449 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENST00000370449 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

BC136419   BM765259   CB120555   NM_000392   U49248   U63970   U66683   X96395  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1,4,7-tris(carboxymethyl)-1,4,7,10-tetraazacyclododecane
  • ABCC2 protein affects the transport of 1,4,7-tris(carboxymethyl)-1,4,7,10-tetraazacyclododecane
15967123
1,4-bis(2-(3,5-dichloropyridyloxy))benzene
  • [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased activity of NR1I3 protein] which results in increased expression of ABCC2 mRNA
15833929
1,4-bis(2-(3,5-dichloropyridyloxy))benzene
  • 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of ABCC2 protein
15986414
1,4-bis(2-(3,5-dichloropyridyloxy))benzene
  • 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of ABCC2 mRNA
15986414, 15833929
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate does not affect the expression of ABCC2 mRNA
14623915
2,4,5-Trichlorophenoxyacetic Acid
  • 2,4,5-Trichlorophenoxyacetic Acid results in increased expression of ABCC2 mRNA
  • 2,4,5-Trichlorophenoxyacetic Acid results in increased expression of ABCC2 mRNA
16426233
2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one
  • 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [erucin results in increased expression of ABCC2 mRNA]
15896333
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of ABCC2 mRNA
16426233, 10691972
2-Acetylaminofluorene
  • 2-Acetylaminofluorene does not affect the expression of ABCC2 mRNA
  • 2-Acetylaminofluorene does not affect the expression of ABCC2 protein
11170838
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of ABCC2 mRNA
16426233, 16381673
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of ABCC2 protein
10691972
2-Acetylaminofluorene
  • NR1I2 protein affects the reaction [2-Acetylaminofluorene results in increased expression of ABCC2 mRNA]
16381673
2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine
  • ABCC2 protein affects the transport of 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine
15057744
2-tert-butylhydroquinone
  • 2-tert-butylhydroquinone results in increased expression of ABCC2 mRNA
11264000
2-tert-butylhydroquinone
  • 2-tert-butylhydroquinone results in increased expression of ABCC2 mRNA
  • 2-tert-butylhydroquinone results in increased expression of ABCC2 protein
11836020
3,4,5,3',4'-pentachlorobiphenyl
  • [3,4,5,3',4'-pentachlorobiphenyl binds to AHR protein] which results in increased expression of ABCC2 mRNA
  • 3,4,5,3',4'-pentachlorobiphenyl results in increased expression of ABCC2 mRNA
15833929
4-(3-pentylamino)-2,7-dimethyl-8-(2-methyl-4-methoxyphenyl)pyrazolo(1,5-a)pyrimidine
  • 4-(3-pentylamino)-2,7-dimethyl-8-(2-methyl-4-methoxyphenyl)pyrazolo(1,5-a)pyrimidine results in increased expression of ABCC2 mRNA
15673846
4-hydroxy-2-nonenal
  • ABCC2 protein affects the export of 4-hydroxy-2-nonenal metabolite
12623073
4-methylumbelliferone
  • ABCC2 protein does not affect the export of 4-methylumbelliferone analog
15598971
5,6-dimethylxanthenoneacetic acid
  • ABCC2 protein affects the export of 5,6-dimethylxanthenoneacetic acid metabolite
15784341
5,6-dimethylxanthenoneacetic acid
  • ABCC2 protein affects the transport of 5,6-dimethylxanthenoneacetic acid analog
15282097
5-carboxyfluorescein diacetate
  • Indomethacin inhibits the reaction [ABCC2 protein affects the export of 5-carboxyfluorescein diacetate]
  • Verapamil inhibits the reaction [ABCC2 protein affects the export of 5-carboxyfluorescein diacetate]
16636798
5-chloromethylfluorescein
  • ABCC2 protein affects the transport of [5-chloromethylfluorescein co-treated with Glutathione]
16049127
6-carboxyfluorescein
  • ABCC2 protein affects the export of 6-carboxyfluorescein
  • Probenecid inhibits the reaction [ABCC2 protein affects the export of 6-carboxyfluorescein]
11477083
6-ethylchenodeoxycholic acid
  • 6-ethylchenodeoxycholic acid results in increased expression of ABCC2 mRNA
15644430
9-nitrocamptothecin
  • 9-nitrocamptothecin results in increased expression of ABCC2 mRNA
15342794
Acetaminophen
  • Acetaminophen results in increased expression of ABCC2 mRNA
15496496
Acetaminophen
  • Acetaminophen results in increased expression of ABCC2 protein
16177239
Acetaminophen
  • ABCC2 protein affects the export of Acetaminophen analog
15860656
Acetaminophen
  • Acetaminophen affects the expression of ABCC2 mRNA
17562736
Adenosine Triphosphate
  • Adenosine Triphosphate promotes the reaction [ABCC2 protein results in increased secretion of Fluo-3]
9794919
Albendazole
  • ABCC2 protein does not affect the transport of Albendazole
15703302
Alkylating Agents
  • ABCC2 protein results in decreased activity of Alkylating Agents
14569069
aluminum chloride
  • aluminum chloride results in increased expression of ABCC2 protein
16084594
Aluminum Hydroxide
  • Aluminum Hydroxide results in decreased expression of ABCC2 protein
14976346
Anticonvulsants
  • ABCC2 protein affects the transport of Anticonvulsants
14636316
Anticonvulsants
  • ABCC2 protein results in chemical resistance to Anticonvulsants
15581025
Antimony Potassium Tartrate
  • Antimony Potassium Tartrate results in increased expression of ABCC2 mRNA
  • Antimony Potassium Tartrate results in increased expression of ABCC2 protein
11408547
apple polyphenol extract
  • apple polyphenol extract results in increased expression of ABCC2 mRNA
18351577
arsenite
  • arsenite results in increased expression of ABCC2 mRNA
  • arsenite results in increased expression of ABCC2 protein
11836020
atorvastatin
  • atorvastatin analog inhibits the reaction [ABCC2 protein results in increased transport of calcein AM]
  • atorvastatin analog results in decreased activity of ABCC2 protein
  • atorvastatin analog inhibits the reaction [ABCC2 protein results in increased transport of calcein AM]
  • atorvastatin analog results in decreased activity of ABCC2 protein
15616150
baicalin
  • ABCC2 protein affects the export of baicalin
15587936
Benzo(a)pyrene
  • Benzo(a)pyrene does not affect the expression of ABCC2 mRNA
15566942
beta-Naphthoflavone
  • beta-Naphthoflavone results in increased expression of ABCC2 mRNA
16426233
beta-Naphthoflavone
  • beta-Naphthoflavone results in increased expression of ABCC2 mRNA
16426233, 15833929
beta-Naphthoflavone
  • [beta-Naphthoflavone binds to AHR protein] which results in increased expression of ABCC2 mRNA
15833929
Bile Acids and Salts
  • Bile Acids and Salts analog results in increased expression of ABCC2 mRNA
11897625
Bile Acids and Salts
  • ABCC2 protein affects the transport of Bile Acids and Salts
12663868
Bile Acids and Salts
  • Bile Acids and Salts promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
  • estradiol-17 beta-glucuronide promotes the reaction [ABCC2 protein affects the transport of Bile Acids and Salts]
12704183
Bilirubin
  • Bilirubin results in decreased activity of ABCC2 protein
15901347
Bilirubin
  • ABCC2 protein affects the transport of Bilirubin
15965653
Bilirubin
  • ABCC2 protein affects the transport of Bilirubin
15374814
bilirubin glucuronate
  • bilirubin glucuronate results in increased expression of ABCC2 mRNA
11897625
biochanin A
  • biochanin A inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
15955639
bis(4-hydroxycinnamoyl)methane
  • bis(4-hydroxycinnamoyl)methane results in decreased activity of ABCC2 protein
15885658
bisphenol A
  • ABCC2 protein affects the export of bisphenol A analog
15466492
Butylated Hydroxyanisole
  • Butylated Hydroxyanisole results in increased expression of ABCC2 mRNA
16426233, 15833929
Butylated Hydroxyanisole
  • [Butylated Hydroxyanisole results in increased activity of NFE2L2 protein] which results in increased expression of ABCC2 mRNA
15833929
Butylated Hydroxyanisole
  • Butylated Hydroxyanisole results in increased expression of ABCC2 mRNA
  • Butylated Hydroxyanisole results in increased expression of ABCC2 protein
16426233
Butyric Acid
  • Butyric Acid does not affect the expression of ABCC2 mRNA
15711177
Cacodylic Acid
  • Cacodylic Acid results in increased expression of ABCC2 mRNA
  • Cacodylic Acid results in increased expression of ABCC2 protein
16436460
Cadmium Chloride
  • Cadmium Chloride does not affect the expression of ABCC2 mRNA
  • Cadmium Chloride does not affect the expression of ABCC2 protein
11408547
Caffeine
  • Caffeine does not affect the activity of ABCC2 protein
15729621
calcein AM
  • ABCC2 protein results in increased transport of calcein AM
  • Lovastatin analog inhibits the reaction [ABCC2 protein results in increased transport of calcein AM]
  • Pravastatin does not affect the reaction [ABCC2 protein results in increased transport of calcein AM]
  • Simvastatin analog inhibits the reaction [ABCC2 protein results in increased transport of calcein AM]
  • atorvastatin analog inhibits the reaction [ABCC2 protein results in increased transport of calcein AM]
  • ABCC2 protein results in increased transport of calcein AM
  • Lovastatin analog inhibits the reaction [ABCC2 protein results in increased transport of calcein AM]
  • Pravastatin does not affect the reaction [ABCC2 protein results in increased transport of calcein AM]
  • Simvastatin analog inhibits the reaction [ABCC2 protein results in increased transport of calcein AM]
  • atorvastatin analog inhibits the reaction [ABCC2 protein results in increased transport of calcein AM]
15616150
calcein AM
  • ABCC2 protein affects the transport of calcein AM
15210835
Carbon Monoxide
  • Carbon Monoxide results in increased activity of ABCC2 protein
13678533
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased activity of ABCC2 protein
16899240
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ABCC2 protein
17544377, 12642476, 16899240
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ABCC2 protein
16177239
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ABCC2 mRNA
15496496
Carbon Tetrachloride
  • [Carbon Tetrachloride co-treated with Valproic Acid] affects the expression of ABCC2 mRNA
17617793
cerivastatin
  • ABCC2 protein affects the export of cerivastatin
15901800
Chlorambucil
  • ABCC2 protein affects the export of Chlorambucil analog
  • ABCC2 protein promotes the reaction [GSTA1 protein results in chemical resistance to Chlorambucil]
14569069
Chlormadinone Acetate
  • Chlormadinone Acetate does not affect the activity of ABCC2 protein
16049127
Cholic Acid
  • Cholic Acid results in increased expression of ABCC2 mRNA
15694933, 11438506, 12971955
Cholic Acid
  • Cholic Acid results in increased expression of ABCC2 protein
11438506
chrysene
  • chrysene does not affect the expression of ABCC2 mRNA
15566942
chrysin
  • chrysin inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
15955639
Cisplatin
  • ABCC2 protein results in chemical resistance to Cisplatin
11455017
Cisplatin
  • ABCC2 protein results in chemical resistance to Cisplatin
8797578, 15688364
Cisplatin
  • ABCC2 protein affects the export of Cisplatin
15985617
Cisplatin
  • ABCC2 affects the chemical susceptibility to Cisplatin
15756446
Clofibric Acid
  • Clofibric Acid results in decreased expression of ABCC2 protein
15908472
Clotrimazole
  • Clotrimazole results in increased expression of ABCC2 mRNA
  • Clotrimazole results in increased expression of ABCC2 protein
11836020
Curcumin
  • Curcumin results in decreased activity of ABCC2 protein
15885658
cyanoginosin LR
  • cyanoginosin LR results in increased expression of ABCC2 mRNA
17654400
Cyclosporine
  • Cyclosporine results in decreased activity of ABCC2 protein
  • Cyclosporine results in decreased activity of ABCC2 protein
15618715
Cyclosporine
  • Cyclosporine results in decreased expression of ABCC2 mRNA
11589784
Cyclosporine
  • Cyclosporine inhibits the reaction [ABCC2 protein results in increased secretion of Fluo-3]
9794919
Dactinomycin
  • ABCC2 protein results in chemical resistance to Dactinomycin
11455017
Dactinomycin
  • Dactinomycin inhibits the reaction [sodium arsenite results in increased expression of ABCC2 mRNA]
11408547
Dapsone
  • Dapsone metabolite results in decreased expression of ABCC2 protein
15863252
demethoxycurcumin
  • demethoxycurcumin results in decreased activity of ABCC2 protein
15885658
Desogestrel
  • Desogestrel does not affect the activity of ABCC2 protein
16049127
Dexamethasone
  • Dexamethasone does not affect the expression of ABCC2 mRNA
15979871
Dexamethasone
  • Dexamethasone results in increased expression of ABCC2 protein
15908472, 15258109
Dexamethasone
  • Dexamethasone results in decreased expression of ABCC2 mRNA
15102944
Dexamethasone
  • Dexamethasone results in increased expression of ABCC2 mRNA
12429353
Dichloroethylenes
  • Dichloroethylenes results in decreased expression of ABCC2 protein
15554242
Diosgenin
  • Diosgenin does not affect the expression of ABCC2 mRNA
15611112
Diosgenin
  • Diosgenin results in increased expression of ABCC2 mRNA
  • [Ethinyl Estradiol co-treated with Diosgenin] results in increased expression of ABCC2 mRNA
16105132
docetaxel
  • ABCC2 protein affects the transport of docetaxel
  • Probenecid promotes the reaction [ABCC2 protein affects the transport of docetaxel]
15849751
Doxorubicin
  • ABCC2 protein results in chemical resistance to Doxorubicin
11455017
E 3040
  • ABCC2 protein affects the export of E 3040 analog
  • ABCC2 protein does not affect the export of E 3040 analog
15598971
Endotoxins
  • Endotoxins inhibits the reaction [Pregnenolone Carbonitrile results in increased expression of ABCC2 mRNA]
15456840
Endotoxins
  • Endotoxins does not affect the expression of ABCC2 protein
15740733
Enkephalin, D-Penicillamine (2,5)-
  • ABCC2 protein affects the export of Enkephalin, D-Penicillamine (2,5)-
15528320
epigallocatechin gallate
  • epigallocatechin gallate does not affect the activity of ABCC2 protein
15729621
erucin
  • 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [erucin results in increased expression of ABCC2 mRNA]
  • PD 98059 inhibits the reaction [erucin results in increased expression of ABCC2 mRNA]
  • erucin results in increased expression of ABCC2 mRNA
15896333
Estradiol
  • ABCC2 protein affects the transport of Estradiol
  • ABCC2 protein affects the transport of Estradiol
15507541
Estradiol
  • Estradiol affects the localization of and affects the activity of ABCC2 protein
15374814
estradiol-17 beta-glucuronide
  • Bile Acids and Salts promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
  • Furosemide promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
  • Probenecid promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
  • estradiol-17 beta-glucuronide promotes the reaction [ABCC2 protein affects the transport of Bile Acids and Salts]
12704183
estradiol-17 beta-glucuronide
  • Indomethacin promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
12704183, 12702717
estradiol-17 beta-glucuronide
  • estradiol-17 beta-glucuronide affects the localization of ABCC2 protein
12893835
estradiol-17 beta-glucuronide
  • Ethinyl Estradiol metabolite promotes the reaction [ABCC2 protein results in increased uptake of estradiol-17 beta-glucuronide]
14722317
estradiol-17 beta-glucuronide
  • ABCC2 protein affects the transport of estradiol-17 beta-glucuronide
  • Leukotriene C4 inhibits the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
  • fluorescein-methotrexate inhibits the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
  • phenolphthalein glucuronide inhibits the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
  • verlukast inhibits the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
9614209
estradiol-17 beta-glucuronide
  • ABCC2 protein affects the transport of estradiol-17 beta-glucuronide
15846474, 11500505, 12702717, 12704183
estradiol-17 beta-glucuronide
  • ABCC2 protein affects the export of estradiol-17 beta-glucuronide
15901800, 15652233
estradiol-17 beta-glucuronide
  • ABCC2 protein affects the transport of estradiol-17 beta-glucuronide
15904671, 12642476
estradiol-17 beta-glucuronide
  • ABCC2 protein affects the chemical susceptibility to estradiol-17 beta-glucuronide
12702498
estradiol-17 beta-glucuronide
  • ABCC2 protein modified form results in increased transport of estradiol-17 beta-glucuronide
15904671
estradiol-17 beta-glucuronide
  • Penicillin G promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
  • pantoprazole promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
  • sulfanitran promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
12702717
estrone sulfate
  • estrone sulfate results in increased activity of ABCC2 protein
  • estrone sulfate results in increased activity of ABCC2 protein modified form
15904671
estrone sulfate
  • ABCC2 protein affects the export of estrone sulfate
16046661, 15652233
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of and results in decreased localization of and results in decreased activity of ABCC2 protein
15843489
Ethinyl Estradiol
  • [Ethinyl Estradiol co-treated with Diosgenin] results in increased expression of ABCC2 mRNA
16105132
Ethinyl Estradiol
  • Ethinyl Estradiol affects the localization of ABCC2 protein
17681005
Ethinyl Estradiol
  • ABCC2 protein results in increased uptake of Ethinyl Estradiol metabolite
  • Ethinyl Estradiol metabolite promotes the reaction [ABCC2 protein results in increased uptake of estradiol-17 beta-glucuronide]
14722317
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ABCC2 protein
16554369
Ethoxyquin
  • [Ethoxyquin results in increased activity of NFE2L2 protein] which results in increased expression of ABCC2 mRNA
  • Ethoxyquin results in increased expression of ABCC2 mRNA
15833929
Etoposide
  • ABCC2 protein affects the transport of Etoposide
15849751, 15751272
Etoposide
  • Probenecid promotes the reaction [ABCC2 protein affects the transport of Etoposide]
15849751
Fenbendazole
  • ABCC2 protein does not affect the transport of Fenbendazole
15703302
Fluo-3
  • ABCC2 protein results in increased secretion of Fluo-3
  • Adenosine Triphosphate promotes the reaction [ABCC2 protein results in increased secretion of Fluo-3]
  • Cyclosporine inhibits the reaction [ABCC2 protein results in increased secretion of Fluo-3]
9794919
fluorescein-methotrexate
  • fluorescein-methotrexate inhibits the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
9614209
fluorexon
  • ABCC2 protein affects the transport of fluorexon
15848949
fluorexon
  • ABCC2 protein affects the export of fluorexon
  • robinetin inhibits the reaction [ABCC2 protein affects the export of fluorexon]
15670588
fluvastatin
  • ABCC2 protein affects the transport of fluvastatin
16026004
Furosemide
  • ABCC2 protein does not affect the export of Furosemide
12608533
Furosemide
  • Furosemide promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
12704183
Fusidic Acid
  • Fusidic Acid results in decreased expression of and results in decreased activity of ABCC2 protein
12106615
gallocatechol
  • gallocatechol does not affect the activity of ABCC2 protein
15729621
Genistein
  • Genistein inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
15955639
Gentamicins
  • Gentamicins does not affect the expression of and affects the activity of ABCC2 protein
15848949
Glutathione
  • ABCC2 protein affects the export of Glutathione
15845416
Glutathione
  • ABCC2 protein affects the transport of [5-chloromethylfluorescein co-treated with Glutathione]
16049127
Glutathione
  • Glutathione promotes the reaction [ABCC2 protein affects the export of phenethyl isothiocyanate]
16002050
GW 4064
  • GW 4064 results in increased expression of ABCC2 mRNA
15644430, 14623915
Hydrocortisone
  • Hydrocortisone does not affect the expression of ABCC2 mRNA
15979871
Indomethacin
  • Indomethacin inhibits the reaction [ABCC2 protein affects the export of 5-carboxyfluorescein diacetate]
16636798
Indomethacin
  • Indomethacin results in decreased activity of ABCC2 protein
16026004
Indomethacin
  • Indomethacin promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
12704183, 12702717
Indomethacin
  • Indomethacin results in decreased expression of ABCC2 mRNA
  • Indomethacin results in decreased expression of ABCC2 protein
17329856
irinotecan
  • ABCC2 protein results in chemical resistance to irinotecan
16815871
irinotecan
  • ABCC2 protein results in increased export of irinotecan
16271446
irinotecan
  • ABCC2 protein does not affect the secretion of irinotecan analog
16003561
L 742694
  • L 742694 results in decreased expression of ABCC2 mRNA
15102944
LE-Cl2MDP
  • LE-Cl2MDP affects the localization of ABCC2 protein
15057914
Leucovorin
  • Leucovorin inhibits the reaction [Methotrexate results in decreased expression of ABCC2 protein]
16925582
Leukotriene C4
  • ABCC2 protein affects the transport of Leukotriene C4
  • Leukotriene C4 inhibits the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
9614209
Leukotriene C4
  • ABCC2 protein affects the transport of Leukotriene C4
15507541
Leukotriene C4
  • ABCC2 protein affects the transport of Leukotriene C4
9430713, 15507541, 15904671
Leukotriene C4
  • ABCC2 protein affects the transport of Leukotriene C4
12395335, 12388192, 11500505
Leukotriene C4
  • ABCC2 protein modified form results in increased transport of Leukotriene C4
15904671
Levonorgestrel
  • Levonorgestrel does not affect the activity of ABCC2 protein
16049127
lipopolysaccharide, E coli O55-B5
  • lipopolysaccharide, E coli O55-B5 results in decreased expression of ABCC2 mRNA
  • lipopolysaccharide, E coli O55-B5 results in decreased expression of ABCC2 protein
11170838
Lipopolysaccharides
  • Lipopolysaccharides does not affect the expression of ABCC2 mRNA
  • Lipopolysaccharides results in decreased expression of ABCC2 protein
15205115
Lipopolysaccharides
  • Lipopolysaccharides affects the localization of and results in decreased expression of ABCC2 protein
12706339
Lipopolysaccharides
  • Lipopolysaccharides results in decreased expression of ABCC2 mRNA
15205389, 15205115
Lipopolysaccharides
  • Lipopolysaccharides results in decreased expression of ABCC2 mRNA
15313196, 15312239
Lithocholic Acid
  • Lithocholic Acid does not affect the expression of ABCC2 mRNA
12637555
Lovastatin
  • Lovastatin analog inhibits the reaction [ABCC2 protein results in increased transport of calcein AM]
  • Lovastatin analog results in decreased activity of ABCC2 protein
  • Lovastatin analog inhibits the reaction [ABCC2 protein results in increased transport of calcein AM]
  • Lovastatin analog results in decreased activity of ABCC2 protein
15616150
Medroxyprogesterone 17-Acetate
  • Medroxyprogesterone 17-Acetate does not affect the activity of ABCC2 protein
16049127
Mercuric Chloride
  • ABCC2 protein affects the export of Mercuric Chloride
  • ABCC2 protein affects the export of and results in chemical resistance to Mercuric Chloride
  • Mercuric Chloride results in increased expression of ABCC2 mRNA
  • Mercuric Chloride results in increased expression of ABCC2 protein
15590114
Mercury
  • ABCC2 protein affects the export of and results in chemical resistance to Mercury
  • Mercury results in increased expression of ABCC2 mRNA
  • Mercury results in increased expression of ABCC2 protein
15590114
Methotrexate
  • ABCC2 protein results in increased export of Methotrexate
12608533
Methotrexate
  • ABCC2 protein affects the export of and results in chemical resistance to Methotrexate
  • ABCC2 protein mutant form does not affect the export of Methotrexate
  • ABCC2 protein mutant form results in chemical sensitivity to Methotrexate
15864128
Methotrexate
  • Leucovorin inhibits the reaction [Methotrexate results in decreased expression of ABCC2 protein]
  • Methotrexate results in decreased expression of ABCC2 mRNA
  • Methotrexate results in decreased expression of ABCC2 protein
16925582
Methotrexate
  • ABCC2 protein affects the transport of Methotrexate
11500505
midecamycin
  • midecamycin results in decreased activity of ABCC2 protein
  • midecamycin results in decreased activity of ABCC2 protein
15618715
Mifepristone
  • Mifepristone results in increased expression of ABCC2 mRNA
15456840
monomethylarsonic acid
  • monomethylarsonic acid results in increased expression of ABCC2 mRNA
  • monomethylarsonic acid results in increased expression of ABCC2 protein
16436460
Mycophenolic Acid
  • ABCC2 protein affects the transport of Mycophenolic Acid metabolite
15816878
myricetin
  • myricetin results in decreased activity of ABCC2 protein
15670588
myricetin
  • myricetin inhibits the reaction [ABCC2 protein affects the export of Vincristine]
  • myricetin inhibits the reaction [ABCC2 protein affects the export of and results in chemical resistance to Vincristine]
  • myricetin inhibits the reaction [ABCC2 protein results in chemical resistance to Vincristine]
15896345
Nelfinavir
  • ABCC2 gene SNP does not affect the response to chemical Nelfinavir
  • ABCC2 protein affects the transport of Nelfinavir
16041239
Nicotine
  • Nicotine metabolite does not affect the activity of ABCC2 protein
15795089
nicotine N-glucuronide
  • nicotine N-glucuronide does not affect the activity of ABCC2 protein
15795089
Nifedipine
  • Nifedipine results in increased expression of ABCC2 mRNA
12206135
NK 104
  • ABCC2 protein affects the transport of NK 104
15955871
Nocodazole
  • Nocodazole results in decreased expression of ABCC2 mRNA
  • Nocodazole results in decreased expression of ABCC2 protein
10691972
Norethindrone
  • Norethindrone does not affect the activity of ABCC2 protein
16049127
norgestimate
  • norgestimate results in decreased activity of ABCC2 protein
16049127
ochratoxin A
  • ochratoxin A results in decreased expression of ABCC2 mRNA
16251485
ochratoxin A
  • ABCC2 protein affects the export of ochratoxin A
  • Genistein inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
  • Quercetin inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
  • biochanin A inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
  • chrysin inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
  • polyphenols inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
  • polyphenols metabolite inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
  • resveratrol inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
15955639
oltipraz
  • [oltipraz results in increased activity of NFE2L2 protein] which results in increased expression of ABCC2 mRNA
  • oltipraz results in increased expression of ABCC2 mRNA
15833929
Paclitaxel
  • ABCC2 protein affects the transport of Paclitaxel
  • ABCC2 protein results in chemical resistance to Paclitaxel
  • Probenecid promotes the reaction [ABCC2 protein affects the transport of Paclitaxel]
  • Probenecid promotes the reaction [ABCC2 protein results in chemical resistance to Paclitaxel]
15849751
Paclitaxel
  • ABCC2 protein affects the chemical susceptibility to Paclitaxel
15645438
pantoprazole
  • pantoprazole promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
12702717
PD 98059
  • PD 98059 inhibits the reaction [erucin results in increased expression of ABCC2 mRNA]
15896333
Penicillin G
  • Penicillin G does not affect the activity of ABCC2 protein modified form
  • Penicillin G results in increased activity of ABCC2 protein
15904671
Penicillin G
  • Penicillin G promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
12702717
Penicillins
  • Penicillins does not affect the expression of and affects the activity of ABCC2 protein
15848949
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ABCC2 mRNA
17681415
Phalloidine
  • Phalloidine results in decreased localization of ABCC2 protein
12169763
phenethyl isothiocyanate
  • ABCC2 protein affects the export of phenethyl isothiocyanate
  • Glutathione promotes the reaction [ABCC2 protein affects the export of phenethyl isothiocyanate]
16002050
Phenobarbital
  • ABCC2 protein does not affect the transport of Phenobarbital
14636316
Phenobarbital
  • Phenobarbital results in increased expression of ABCC2 mRNA
  • Phenobarbital results in increased expression of ABCC2 protein
15986414
Phenobarbital
  • Phenobarbital does not affect the expression of ABCC2 mRNA
11451172
Phenobarbital
  • Phenobarbital results in increased expression of ABCC2 protein
15908472
phenolphthalein glucuronide
  • phenolphthalein glucuronide inhibits the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
9614209
phenolphthalein glucuronide
  • ABCC2 protein affects the export of phenolphthalein glucuronide
11348857
Phenolsulfonphthalein
  • ABCC2 protein affects the export of Phenolsulfonphthalein
15618741
Phenytoin
  • ABCC2 protein affects the transport of Phenytoin
14636316, 12663688
Phenytoin
  • ABCC2 protein affects the chemical susceptibility to Phenytoin
17376120
PKI 166
  • ABCC2 protein affects the transport of PKI 166 metabolite
  • ABCC2 protein affects the transport of PKI 166 metabolite
15280219
Plant Extracts
  • Plant Extracts does not affect the expression of ABCC2 mRNA
  • Plant Extracts results in decreased activity of ABCC2 protein
15729621
Plant Extracts
  • Plant Extracts results in increased expression of ABCC2 mRNA
18351577
Platinum
  • ABCC2 protein results in chemical resistance to Platinum
15688364
pluronic block copolymer p85
  • pluronic block copolymer p85 results in decreased folding of and results in decreased activity of ABCC2 protein
15648254
polydatin
  • ABCC2 protein affects the export of polydatin
15686436
polyphenols
  • polyphenols inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
  • polyphenols metabolite inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
15955639
Pravastatin
  • ABCC2 protein affects the transport of Pravastatin
15901796
Pravastatin
  • ABCC2 protein affects the transport of Pravastatin
15955871
Pravastatin
  • ABCC2 protein affects the export of Pravastatin
15901800
Pravastatin
  • Pravastatin does not affect the reaction [ABCC2 protein results in increased transport of calcein AM]
  • Pravastatin does not affect the reaction [ABCC2 protein results in increased transport of calcein AM]
15616150
Pregnenolone Carbonitrile
  • Pregnenolone Carbonitrile does not affect the expression of ABCC2 mRNA
  • Pregnenolone Carbonitrile results in increased expression of ABCC2 protein
15917434
Pregnenolone Carbonitrile
  • Endotoxins inhibits the reaction [Pregnenolone Carbonitrile results in increased expression of ABCC2 mRNA]
  • Pregnenolone Carbonitrile results in increased expression of ABCC2 mRNA
15456840
Probenecid
  • Probenecid promotes the reaction [ABCC2 protein affects the transport of Etoposide]
  • Probenecid promotes the reaction [ABCC2 protein affects the transport of Paclitaxel]
  • Probenecid promotes the reaction [ABCC2 protein affects the transport of Vinblastine]
  • Probenecid promotes the reaction [ABCC2 protein affects the transport of docetaxel]
  • Probenecid promotes the reaction [ABCC2 protein results in chemical resistance to Paclitaxel]
  • Probenecid results in increased activity of ABCC2 protein
15849751
Probenecid
  • Probenecid promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
12704183
Probenecid
  • ABCC2 protein results in increased export of Probenecid
12608533
Probenecid
  • Probenecid inhibits the reaction [ABCC2 protein affects the export of 6-carboxyfluorescein]
11477083
Probenecid
  • Probenecid does not affect the activity of ABCC2 protein modified form
  • Probenecid results in increased activity of ABCC2 protein
15904671
Progesterone
  • Progesterone results in decreased activity of ABCC2 protein
16049127
prulifloxacin
  • ABCC2 protein affects the transport of prulifloxacin metabolite
15618759
pyrene
  • pyrene does not affect the expression of ABCC2 mRNA
15566942
Quercetin
  • Quercetin does not affect the activity of ABCC2 protein
15041478
Quercetin
  • Quercetin inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
15955639
Quercetin
  • Quercetin inhibits the reaction [sodium arsenite results in increased expression of ABCC2 mRNA]
11408547
Reactive Oxygen Species
  • Reactive Oxygen Species results in increased expression of ABCC2
11264000
resveratrol
  • ABCC2 protein affects the export of resveratrol
15686436
resveratrol
  • resveratrol inhibits the reaction [ABCC2 protein affects the export of ochratoxin A]
15955639
Rifampin
  • Rifampin results in increased expression of ABCC2 mRNA
12206135, 11836020
Rifampin
  • Rifampin results in increased expression of ABCC2 protein
11836020
Rifampin
  • ABCC2 protein affects the export of Rifampin
15652233
robinetin
  • robinetin inhibits the reaction [ABCC2 protein affects the export of fluorexon]
  • robinetin results in decreased activity of ABCC2 protein
15670588
S-(2,4-dinitrophenyl)glutathione
  • ABCC2 protein affects the transport of S-(2,4-dinitrophenyl)glutathione
9430713, 15901347, 15652244
S-(2,4-dinitrophenyl)glutathione
  • ABCC2 protein affects the transport of S-(2,4-dinitrophenyl)glutathione
9525973, 15846474
Saquinavir
  • ABCC2 protein affects the transport of Saquinavir
12702717
Saquinavir
  • ABCC2 protein affects the export of Saquinavir
15832500
Simvastatin
  • Simvastatin analog inhibits the reaction [ABCC2 protein results in increased transport of calcein AM]
  • Simvastatin analog results in decreased activity of ABCC2 protein
  • Simvastatin analog inhibits the reaction [ABCC2 protein results in increased transport of calcein AM]
  • Simvastatin analog results in decreased activity of ABCC2 protein
15616150
Sincalide
  • ABCC2 protein affects the export of Sincalide
16046661, 15665139
Sirolimus
  • Sirolimus results in decreased expression of ABCC2 mRNA
11589784
sodium arsenate
  • sodium arsenate results in increased expression of ABCC2 mRNA
  • sodium arsenate results in increased expression of ABCC2 protein
11408547
sodium arsenate
  • sodium arsenate results in increased expression of ABCC2 mRNA
12727804
sodium arsenite
  • sodium arsenite results in increased expression of ABCC2 protein
  • Dactinomycin inhibits the reaction [sodium arsenite results in increased expression of ABCC2 mRNA]
  • Quercetin inhibits the reaction [sodium arsenite results in increased expression of ABCC2 mRNA]
11408547
sodium arsenite
  • ABCC2 protein results in chemical resistance to sodium arsenite
11455017
sodium arsenite
  • sodium arsenite results in increased expression of ABCC2 mRNA
  • sodium arsenite results in increased expression of ABCC2 protein
11455017, 11408547
sodium arsenite
  • sodium arsenite results in increased expression of ABCC2 mRNA
12727804, 11408547
Soybean Oil
  • Soybean Oil affects the expression of ABCC2 mRNA
15770074
Spironolactone
  • Spironolactone results in increased expression of ABCC2 protein
15652244
Streptomycin
  • Streptomycin does not affect the expression of and affects the activity of ABCC2 protein
15848949
sulfanitran
  • sulfanitran results in increased activity of ABCC2 protein
  • sulfanitran promotes the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
12702717
Sulfinpyrazone
  • Sulfinpyrazone results in decreased activity of ABCC2 protein
14569069
Sulfinpyrazone
  • Sulfinpyrazone inhibits the reaction [ABCC2 protein results in increased export of Vinblastine]
11834888
Sulfobromophthalein
  • ABCC2 protein affects the export of Sulfobromophthalein
16046661
Sulfobromophthalein
  • ABCC2 protein affects the transport of Sulfobromophthalein
17329856
sulforafan
  • sulforafan results in increased expression of ABCC2 mRNA
15896333, 11264000
sulforafan
  • sulforafan results in increased expression of ABCC2 protein
  • sulforafan results in increased expression of ABCC2 mRNA
  • sulforafan results in increased expression of ABCC2 protein
11264000
Taurine
  • Taurine results in increased expression of ABCC2 protein
12706339
Taurochenodeoxycholic Acid
  • Taurochenodeoxycholic Acid results in increased expression of ABCC2 protein
11672435
Taurocholic Acid
  • Taurocholic Acid results in increased activity of ABCC2 protein
  • Taurocholic Acid results in increased activity of ABCC2 protein modified form
15904671
Taurocholic Acid
  • Taurocholic Acid results in increased expression of and results in increased activity of ABCC2 protein
12644037
Taurocholic Acid
  • ABCC2 protein does not affect the transport of Taurocholic Acid
11557524
tauromuricholic acid
  • tauromuricholic acid results in increased expression of and results in increased activity of ABCC2 protein
12644037
tauromuricholic acid
  • tauromuricholic acid results in increased expression of ABCC2 protein
11672435
tauroursodeoxycholic acid
  • tauroursodeoxycholic acid results in increased expression of and results in increased activity of ABCC2 protein
12644037
tauroursodeoxycholic acid
  • tauroursodeoxycholic acid results in increased expression of ABCC2 protein
11672435
tauroursodeoxycholic acid
  • tauroursodeoxycholic acid does not affect the expression of ABCC2 mRNA
14623915
temocaprilat
  • ABCC2 protein affects the transport of temocaprilat
15507541, 11348856
temocaprilat
  • ABCC2 protein affects the transport of temocaprilat
15507541
Tetrachlorodibenzodioxin
  • [Tetrachlorodibenzodioxin binds to AHR protein] which results in increased expression of ABCC2 mRNA
  • Tetrachlorodibenzodioxin results in increased expression of ABCC2 mRNA
15833929
Tretinoin
  • Tretinoin results in decreased expression of ABCC2 mRNA
16604517
trichostatin A
  • trichostatin A results in decreased expression of ABCC2 mRNA
  • trichostatin A results in decreased expression of ABCC2 protein
10691972
trimethylarsine oxide
  • trimethylarsine oxide results in increased expression of ABCC2 mRNA
  • trimethylarsine oxide results in increased expression of ABCC2 protein
16436460
Turpentine
  • Turpentine results in decreased expression of ABCC2 mRNA
15313196
Uric Acid
  • ABCC2 protein does not affect the export of Uric Acid
15454390
Ursodeoxycholic Acid
  • Ursodeoxycholic Acid results in increased expression of ABCC2 protein
15956029
Ursodeoxycholic Acid
  • Ursodeoxycholic Acid results in increased activity of ABCC2 protein
15843489
Ursodeoxycholic Acid
  • Ursodeoxycholic Acid results in increased expression of ABCC2 protein
11438506
Ursodeoxycholic Acid
  • Ursodeoxycholic Acid results in increased expression of ABCC2 mRNA
12971955, 11438506
Valproic Acid
  • [Carbon Tetrachloride co-treated with Valproic Acid] affects the expression of ABCC2 mRNA
17617793
Verapamil
  • Verapamil inhibits the reaction [ABCC2 protein affects the export of 5-carboxyfluorescein diacetate]
16636798
Verapamil
  • Verapamil results in decreased activity of ABCC2 protein
16026006
verlukast
  • verlukast results in decreased activity of ABCC2 protein
  • verlukast results in decreased activity of ABCC2 protein modified form
15904671
verlukast
  • verlukast results in decreased activity of ABCC2 protein
15729621, 15451006
verlukast
  • verlukast inhibits the reaction [ABCC2 protein affects the transport of estradiol-17 beta-glucuronide]
9614209
verlukast
  • verlukast results in decreased activity of ABCC2 protein
15590114, 11455017, 12490585, 15282097
Vinblastine
  • ABCC2 protein results in increased export of Vinblastine
  • Sulfinpyrazone inhibits the reaction [ABCC2 protein results in increased export of Vinblastine]
11834888
Vinblastine
  • ABCC2 protein affects the transport of Vinblastine
9525973, 15849751
Vinblastine
  • Probenecid promotes the reaction [ABCC2 protein affects the transport of Vinblastine]
15849751
Vinblastine
  • ABCC2 protein results in chemical resistance to Vinblastine
11455017
Vincristine
  • ABCC2 protein affects the export of Vincristine
  • ABCC2 protein affects the export of and results in chemical resistance to Vincristine
  • ABCC2 protein results in chemical resistance to Vincristine
  • myricetin inhibits the reaction [ABCC2 protein affects the export of Vincristine]
  • myricetin inhibits the reaction [ABCC2 protein affects the export of and results in chemical resistance to Vincristine]
  • myricetin inhibits the reaction [ABCC2 protein results in chemical resistance to Vincristine]
15896345
wortmannin
  • wortmannin affects the localization of ABCC2 protein
12702492
Z 335
  • ABCC2 protein affects the export of Z 335
12486683

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Cholestasis marker 17681005
Heart Diseases marker 16330681
Jaundice, Chronic Idiopathic marker
Carcinoma, Renal Cell inferred via Vincristine 16201981
Hodgkin Disease inferred via Vincristine 17606976, 16135485, 15147373, 16794504
Melanoma, Amelanotic inferred via Vincristine 15990972
Myocardial Infarction inferred via Vincristine 17284715
Hodgkin Disease inferred via Vinblastine 18180244, 18501091
Melanoma inferred via Vinblastine 16809738, 15577320, 16432458, 16248763, 18176117, 17761969, 18332650, 12374674, 15577323, 18505091
Neutropenia inferred via Vinblastine 17378895
Vaginal Neoplasms inferred via Vinblastine 15577323
Dystonia inferred via Valproic Acid 1851702
Fatty Liver inferred via Valproic Acid 14986274
Leukemia, Myeloid, Acute inferred via Valproic Acid 16294345
Migraine Disorders inferred via Valproic Acid 18765137, 18803445
Pseudolymphoma inferred via Valproic Acid 12752131
Seizures inferred via Valproic Acid 11738929
Unverricht-Lundborg Syndrome inferred via Valproic Acid 3119515
Cholestasis inferred via Ursodeoxycholic Acid 16487557
Cholestasis, Intrahepatic inferred via Ursodeoxycholic Acid 14728856
Diabetes Mellitus, Type 1 inferred via Uric Acid 16506275
Acute-Phase Reaction inferred via Turpentine 16044259
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16443354, 16166294
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16935935, 15748426, 12679006, 16823087, 16788101, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17506722, 17217047, 16766008, 17107899
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Liver Cirrhosis, Experimental inferred via Taurine 15893842, 15931870
Adenomatous Polyposis Coli inferred via sulforafan 17942926
Adrenal Gland Neoplasms inferred via sodium arsenite 15276417
Adrenocortical Adenoma inferred via sodium arsenite 16712894
Carcinoma, Hepatocellular inferred via sodium arsenite 15276417, 16507464
Carcinoma, Squamous Cell inferred via sodium arsenite 18572023
Genital Neoplasms, Female inferred via sodium arsenite 16452187
Hodgkin Disease inferred via sodium arsenite 12676792
Liver Neoplasms inferred via sodium arsenite 15276417, 16712894
Lung Neoplasms inferred via sodium arsenite 15276417, 16712894, 17077188
Melanoma inferred via sodium arsenite 16487513
Neoplasms inferred via sodium arsenite 11559025
Neural Tube Defects inferred via sodium arsenite 12854658
Ovarian Neoplasms inferred via sodium arsenite 15276417
Prostatic Neoplasms inferred via sodium arsenite 16039940
Skin Neoplasms inferred via sodium arsenite 18572023
Spinal Dysraphism inferred via sodium arsenite 12854658
Urinary Bladder Neoplasms inferred via sodium arsenite 11723127, 16712894, 16452187
Uterine Cervical Neoplasms inferred via sodium arsenite 11813266
Vascular Diseases inferred via sodium arsenite 17056641
Neural Tube Defects inferred via sodium arsenate 11749123
Hyperlipoproteinemia Type II inferred via Simvastatin 16238680
Polycystic Ovary Syndrome inferred via Simvastatin 17105841
HIV Infections inferred via Saquinavir 15388451
Mycobacterium Infections inferred via Rifampin 18474467
Tuberculosis inferred via Rifampin 18397238, 15236969
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 16267019, 16490592, 17049120, 17164350, 17935668
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 16317513, 16456233, 17015251, 17125593, 16525036
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 15767336, 17636462, 17804756, 16731767, 17718901
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 16314181, 15827377, 16317513, 17520802
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Melanoma inferred via Reactive Oxygen Species 17992120
Pancreatic Neoplasms inferred via Reactive Oxygen Species 15580305
Cadmium Poisoning inferred via Quercetin 16962696
Influenza, Human inferred via Quercetin 16624496
Kidney Diseases inferred via Quercetin 16962696
Liver Cirrhosis, Experimental inferred via Quercetin 12741479
Neurogenic Inflammation inferred via Quercetin 17929310
Pancreatic Neoplasms inferred via Quercetin 16965848
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15380490, 15845082
Breast Neoplasms inferred via Progesterone 17614352, 16175315, 15562024
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Hypercholesterolemia inferred via Pravastatin 17188708
Myocardial Infarction inferred via Pravastatin 17188708
Colonic Neoplasms inferred via polyphenols 16293270
Inflammation inferred via polyphenols 16366677
Liver Diseases inferred via polyphenols 16698588
Melanoma inferred via Platinum 16814760
Neuroblastoma inferred via Platinum 16814760
Alzheimer Disease inferred via Plant Extracts 16962711
Brain Ischemia inferred via Plant Extracts 16041641
HIV Infections inferred via Plant Extracts 12878215
Hot Flashes inferred via Plant Extracts 16566672
Hyperhomocysteinemia inferred via Plant Extracts 16484555
Inflammation inferred via Plant Extracts 16366677
Liver Cirrhosis, Experimental inferred via Plant Extracts 15479170
Neurobehavioral Manifestations inferred via Plant Extracts 17168769
Prostatic Neoplasms inferred via Plant Extracts 17804756
Abnormalities, Drug-Induced inferred via Phenytoin 3425630, 10563481
Atherosclerosis inferred via Phenytoin 15136057
Cleft Palate inferred via Phenytoin 2227380, 10789828, 3877104, 6856622, 1687470, 6862529
Congenital Abnormalities inferred via Phenytoin 10627286
Drug Eruptions inferred via Phenytoin 15024534
Epidermolysis Bullosa inferred via Phenytoin 6251365, 1399206
Epilepsies, Partial inferred via Phenytoin 17116037
Epilepsy inferred via Phenytoin 11434505
Fetal Death inferred via Phenytoin 10627286
Gingival Hyperplasia inferred via Phenytoin 9029455
Gingival Overgrowth inferred via Phenytoin 16390469, 14659971
Hyperhomocysteinemia inferred via Phenytoin 10459572
Liver Diseases inferred via Phenytoin 14986274
Myoclonic Epilepsies, Progressive inferred via Phenytoin 17484760
Myotonia Congenita inferred via Phenytoin 1896199
Osteomalacia inferred via Phenytoin 17016548
Pseudolymphoma inferred via Phenytoin 1419762, 12752131, 8603615
Dystonia inferred via Phenobarbital 1851702
Epilepsy, Absence inferred via Phenobarbital 6401628
Liver Neoplasms inferred via Phenobarbital 15975961, 8742319
Myoclonic Epilepsies, Progressive inferred via Phenobarbital 17484760
Osteomalacia inferred via Phenobarbital 17016548
Pancreatic Neoplasms inferred via Phenobarbital 16965848
Pseudolymphoma inferred via Phenobarbital 12752131
Seizures, Febrile inferred via Phenobarbital 6407741
Testicular Diseases inferred via phenethyl isothiocyanate 15864552
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Leukemia, Monocytic, Acute inferred via PD 98059 16972261
Breast Neoplasms inferred via Paclitaxel 16244791, 18234424, 15136595, 11325840, 18323546
Carcinoma, Hepatocellular inferred via Paclitaxel 16313753
Liposarcoma inferred via Paclitaxel 17353645
Lymphoma, Non-Hodgkin inferred via Paclitaxel 14749477
Melanoma inferred via Paclitaxel 16342250, 12040289
Multiple Myeloma inferred via Paclitaxel 14749477
Ovarian Neoplasms inferred via Paclitaxel 11161223
Prostatic Neoplasms inferred via Paclitaxel 16356831, 17136230, 16729912
Liver Cirrhosis, Experimental inferred via oltipraz 16544323
Breast Neoplasms inferred via ochratoxin A 11921183
Kidney Diseases inferred via ochratoxin A 11409539
Kidney Neoplasms inferred via ochratoxin A 16251485
Acne Vulgaris inferred via norgestimate 17505938
Heart Failure inferred via NK 104 15502390
Alzheimer Disease inferred via Nicotine 16627626
Neoplasms inferred via Nicotine 16365874
Neovascularization, Pathologic inferred via Nicotine 16365874
HIV Infections inferred via Nelfinavir 15388451
Endometriosis inferred via Mifepristone 16134523
Ovarian Neoplasms inferred via Mifepristone 16525653
Arthritis, Rheumatoid inferred via Methotrexate 17286800
Breast Neoplasms inferred via Methotrexate 16978400
Graft vs Host Disease inferred via Methotrexate 16518429
Liver Cirrhosis inferred via Methotrexate 14986274
Mucositis inferred via Methotrexate 17488658
Psoriasis inferred via Methotrexate 17410198
Autoimmune Diseases inferred via Mercury 16634805
Glycosuria, Renal inferred via Mercuric Chloride 2918855
Renal Aminoacidurias inferred via Mercuric Chloride 2918855
Ovarian Neoplasms inferred via Medroxyprogesterone 17-Acetate 17393432
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
Cholestasis inferred via Levonorgestrel 15861022
Osteoporosis inferred via Levonorgestrel 12665316
Pruritus inferred via Levonorgestrel 15861022
Venous Thrombosis inferred via Levonorgestrel 15869587
Colorectal Neoplasms inferred via Leucovorin 17594712, 17255274, 17401013, 17454858, 16303861
Craniofacial Abnormalities inferred via Leucovorin 16925845
Reperfusion Injury inferred via Leucovorin 17295595
Colonic Neoplasms inferred via irinotecan 17725105
Colorectal Neoplasms inferred via irinotecan 16303861, 15273666, 18259882, 17454858
Neoplasm Metastasis inferred via irinotecan 18259882
Stomach Neoplasms inferred via irinotecan 15723263
Adenoma inferred via Indomethacin 11497255
Alzheimer Disease inferred via Indomethacin 15579461
Breast Neoplasms inferred via Indomethacin 17401462
Carcinoma, Hepatocellular inferred via Indomethacin 16391822
Colonic Neoplasms inferred via Indomethacin 11260862, 15963497, 15786552
Colorectal Neoplasms inferred via Indomethacin 18059344, 17054584, 12606626
Duodenal Ulcer inferred via Indomethacin 17045617, 17202747, 16699067
Edema inferred via Indomethacin 8985016
Enteritis inferred via Indomethacin 16328016
Esophageal Neoplasms inferred via Indomethacin 11005569
Glioblastoma inferred via Indomethacin 12870263
Hyperlipidemias inferred via Indomethacin 17546600
Ileal Diseases inferred via Indomethacin 10574470
Intestinal Diseases inferred via Indomethacin 15610444, 10210152, 17329856, 15831440
Jejunal Diseases inferred via Indomethacin 10574470
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via Indomethacin 10785260
Leukemia, Myeloid, Acute inferred via Indomethacin 18360721
Lung Neoplasms inferred via Indomethacin 11497255
Pain inferred via Indomethacin 17440234
Stomach Diseases inferred via Indomethacin 17207306
Stomach Ulcer inferred via Indomethacin 16934674, 15104355, 12467913, 10878458, 18299717, 17654042, 12077510
Ulcer inferred via Indomethacin 10574470
Cleft Palate inferred via Hydrocortisone 15826874
Carcinoma, Squamous Cell inferred via Glutathione 17015178
Hypercalciuria inferred via Gentamicins 17652376
Breast Neoplasms inferred via Genistein 17200150, 16873071, 16541309
Carcinoma, Hepatocellular inferred via Genistein 16924424
Cardiovascular Diseases inferred via Genistein 16332659
Colonic Neoplasms inferred via Genistein 17182828
Diabetes Mellitus, Type 2 inferred via Genistein 16647724
Endometrial Hyperplasia inferred via Genistein 16402032
Glioblastoma inferred via Genistein 16598420
Liver Cirrhosis, Experimental inferred via Genistein 17823541
Mammary Neoplasms, Experimental inferred via Genistein 14578162, 12929590
Myocardial Infarction inferred via Genistein 17141266
Myocardial Reperfusion Injury inferred via Genistein 17141266
Osteoporosis, Postmenopausal inferred via Genistein 16169203
Prostatic Neoplasms inferred via Genistein 16925846, 15256057, 15378649
Dyspnea inferred via Furosemide 16935035
Edema inferred via Furosemide 11834646
Heart Failure inferred via Furosemide 16011733, 16845234, 12660669
Hypercalcemia inferred via Furosemide 17652376
Hypercalciuria inferred via Furosemide 17652376
Hyperparathyroidism, Secondary inferred via Furosemide 15086907
Hypertension, Pregnancy-Induced inferred via Furosemide 16612254
Hypoproteinemia inferred via Furosemide 16096441
Nephrocalcinosis inferred via Furosemide 15086907
Nocturnal Enuresis inferred via Furosemide 17945291
Polyuria inferred via Furosemide 17945291
Reperfusion Injury inferred via Furosemide 16526316
Respiratory Distress Syndrome, Adult inferred via Furosemide 12394941, 16096441, 15912074
Stomach Neoplasms inferred via Furosemide 17052386
Coronary Disease inferred via fluvastatin 16142594
Bone Marrow Neoplasms inferred via Etoposide 14601052
Breast Neoplasms inferred via Etoposide 16322251
Herpes Simplex inferred via Etoposide 10809021
Hodgkin Disease inferred via Etoposide 17606976, 15147373, 16135485, 18180244, 16200630
Lymphoma inferred via Etoposide 12556972, 12854902
Sarcoma, Ewing's inferred via Etoposide 14601052
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 17681005, 17333356, 11677210, 15861022, 16105132
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Breast Neoplasms inferred via estrone sulfate 17261762
Breast Neoplasms inferred via Estradiol 17289903, 18497071, 17261762, 17018787, 12948864, 14630087
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 16891317, 11807958, 11408345
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Asthma inferred via epigallocatechin gallate 16516891
Diabetes Mellitus, Type 2 inferred via epigallocatechin gallate 16988119
Liver Cirrhosis, Experimental inferred via epigallocatechin gallate 17481882
Melanoma inferred via epigallocatechin gallate 17992120, 11746506
Muscular Atrophy, Spinal inferred via epigallocatechin gallate 17962980
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 15939500, 17426702, 18628466, 16935488, 18234424, 15668708, 15567936, 15136595, 11325840, 16322301, 16096432, 15993339, 15634643, 15994142, 16264153, 17369602, 18382427, 16826403, 17983394
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 16234567, 17876044, 16023760
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 15811867, 17308081, 17007740, 17382496, 16364871, 16651473, 17351982, 17131338, 16455267, 18627295, 17329180, 16731534, 17974986, 15505089, 16278810, 15476868, 16269455, 16109756, 16242529
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16244371, 16879835, 16144979, 16330681, 16244372
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 18501091, 15147373
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 16888761, 15749863, 18437689, 16868541, 16729912
Sarcoma inferred via Doxorubicin 18313854, 16767912, 17710206, 17203757, 15625365, 15675481
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 17203757, 15625365
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871
Breast Neoplasms inferred via docetaxel 15692762, 17369602, 15567936, 16264153, 18628466
Melanoma inferred via docetaxel 12417787
Prostatic Neoplasms inferred via docetaxel 16644109, 16520278
Cholestasis inferred via Diosgenin 16105132
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 16118317, 15744524
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Hemosiderosis inferred via Dapsone 17053738
Liver Diseases inferred via Dapsone 17053738
Bone Marrow Neoplasms inferred via Dactinomycin 14601052
Sarcoma, Ewing's inferred via Dactinomycin 14601052
Gingival Hyperplasia inferred via Cyclosporine 8708960
Metal Metabolism, Inborn Errors inferred via Cyclosporine 16801185
Nephrosis, Lipoid inferred via Cyclosporine 17954296
Nephrotic Syndrome inferred via Cyclosporine 18481113
Psoriasis inferred via Cyclosporine 16882103
Hepatitis, Toxic inferred via cyanoginosin LR 17654400
Breast Neoplasms inferred via Curcumin 16243823
Inflammation inferred via Curcumin 16956363, 17151092
Leukemia-Lymphoma, Adult T-Cell inferred via Curcumin 16106398
Leukemia, T-Cell inferred via Curcumin 16106398
Liver Cirrhosis, Experimental inferred via Curcumin 18006644
Liver Diseases inferred via Curcumin 16956363
Lung Neoplasms inferred via Curcumin 16243823
Lymphoma, T-Cell inferred via Curcumin 16173963
Memory Disorders inferred via Curcumin 17263510
Muscular Atrophy, Spinal inferred via Curcumin 17962980
Respiratory Distress Syndrome, Adult inferred via Curcumin 10666014
Liver Neoplasms inferred via Clofibric Acid 17602206
Adenocarcinoma inferred via Cisplatin 11798837
Bone Marrow Neoplasms inferred via Cisplatin 14601052
Breast Neoplasms inferred via Cisplatin 18382427
Colorectal Neoplasms inferred via Cisplatin 15273666
Hodgkin Disease inferred via Cisplatin 16170182, 16200630
Kidney Failure, Acute inferred via Cisplatin 12690470
Lung Neoplasms inferred via Cisplatin 11798837, 17225452
Melanoma inferred via Cisplatin 16809738, 16432458, 17023156, 15577323, 18176117, 18505091, 16248763, 17761969, 12393984, 12374674, 12883367, 18332650
Melanoma, Amelanotic inferred via Cisplatin 15990972
Neoplasms inferred via Cisplatin 16773208
Ovarian Neoplasms inferred via Cisplatin 17225452
Sarcoma, Ewing's inferred via Cisplatin 14601052
Testicular Neoplasms inferred via Cisplatin 17225452
Urinary Bladder Neoplasms inferred via Cisplatin 12973940, 17225452
Vaginal Neoplasms inferred via Cisplatin 15577323
Lymphoma inferred via Chlorambucil 10745627
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15673190, 16050911, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 16239168, 12795759, 61145, 12631006, 17595544
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15998439, 15027814, 15968718, 16227642, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 17334410, 16239168, 16221502
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 18395095, 18156304, 17976157, 17557913, 17805973, 17525996, 16248980, 15925388, 16116963, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 18376398, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 15830285, 17285989, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Colitis inferred via Carbon Monoxide 16365149
Liver Diseases inferred via Carbon Monoxide 17173083
Hepatitis inferred via Caffeine 11394713
Kidney Diseases inferred via Cadmium Chloride 16962696
Urinary Bladder Neoplasms inferred via Cacodylic Acid 15537745
Breast Neoplasms inferred via bisphenol A 17123778
Carcinoma in Situ inferred via bisphenol A 17123778
Insulin Resistance inferred via bisphenol A 16393666
Prostatic Neoplasms inferred via bisphenol A 16740699
Substance-Related Disorders inferred via bisphenol A 16684133, 16045194
Uterine Diseases inferred via bisphenol A 14652134
Glioblastoma inferred via biochanin A 16598420
Prostatic Neoplasms inferred via biochanin A 12111696
Esophageal Neoplasms inferred via Benzo(a)pyrene 16530937
Lung Neoplasms inferred via Benzo(a)pyrene 17053015
Urinary Bladder Neoplasms inferred via Benzo(a)pyrene 17053015
Liver Cirrhosis, Experimental inferred via baicalin 18187930
Prostatic Neoplasms inferred via baicalin 15714805
Coronary Artery Disease inferred via atorvastatin 16368305
Heart Failure inferred via atorvastatin 16360360
Hyperlipoproteinemia Type II inferred via atorvastatin 16238680
Liver Cirrhosis, Experimental inferred via atorvastatin 17347453
Colonic Neoplasms inferred via arsenite 15037631
Lung Neoplasms inferred via arsenite 16809336
Neovascularization, Pathologic inferred via arsenite 15738583
Hepatitis, Toxic inferred via Acetaminophen 2444490, 15968718, 16227642, 16177239, 14986274, 17562736, 16081117, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Liver Cirrhosis, Experimental inferred via 6-ethylchenodeoxycholic acid 15860571, 15980055
Mammary Neoplasms, Experimental inferred via 5,6-dimethylxanthenoneacetic acid 16944150
Amyotrophic Lateral Sclerosis inferred via 4-hydroxy-2-nonenal 10965797
Photosensitivity Disorders inferred via 4-hydroxy-2-nonenal 11550810
Adenoma, Liver Cell inferred via 3,4,5,3',4'-pentachlorobiphenyl 16628245
Cholangiocarcinoma inferred via 3,4,5,3',4'-pentachlorobiphenyl 16628245
Adenoma inferred via 2-Acetylaminofluorene 10737359
Carcinoma, Hepatocellular inferred via 2-Acetylaminofluorene 10737359
Liver Neoplasms inferred via 2-Acetylaminofluorene 10737359, 14678523, 10672840, 11376686, 16273603, 18001218
Lung Neoplasms inferred via 2-Acetylaminofluorene 11376686
Urinary Bladder Neoplasms inferred via 2-Acetylaminofluorene 15867355, 15289314
Leukemia inferred via 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one 12970779
Ovarian Neoplasms inferred via 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one 16211241
Cholestasis, Intrahepatic inferred via 1-Naphthylisothiocyanate 10220858
Hepatitis, Toxic inferred via 1-Naphthylisothiocyanate 17522070
Liver Diseases inferred via 1-Naphthylisothiocyanate 17184895

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
PDZK1 PDZK1 / ABCC2 Two-hybrid Kocher O (1999)
PDZK2 ABCC2 / PDZK2 Reconstituted Complex Hegedus T (2003)
Rdx ABCC2 / Rdx Reconstituted Complex Kikuchi S (2002)
SLC9A3R1 ABCC2 / SLC9A3R1 Reconstituted Complex Hegedus T (2003)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kim DW, et al. (2009) "Lack of association between ABCB1, ABCG2, and ABCC2 genetic polymorphisms and multidrug resistance in partial epilepsy." Epilepsy Res. 84(1):86-90. PMID:19167193
  2. [ + ] Ufer M, et al. (2009) "Non-response to antiepileptic pharmacotherapy is associated with the ABCC2 -24C>T polymorphism in young and adult patients with epilepsy." Pharmacogenet Genomics. 19(5):353-362. PMID:19415824
  3. [ + ] Qadri I, et al. (2009) "Interaction of hepatocyte nuclear factors in transcriptional regulation of tissue specific hormonal expression of human multidrug resistance-associated protein 2 (abcc2)." Toxicol Appl Pharmacol. 234(3):281-292. PMID:19010343
  4. [ + ] Innocenti F, et al. (2009) "Comprehensive pharmacogenetic analysis of irinotecan neutropenia and pharmacokinetics." J Clin Oncol. 27(16):2604-2614. PMID:19349540
  5. [ + ] Minami S, et al. (2009) "Posttranslational regulation of Abcc2 expression by SUMOylation system." Am J Physiol Gastrointest Liver Physiol. 296(2):G406-G413. PMID:19074644
  6. [ + ] Grisk O, et al. (2009) "Multidrug resistance-related protein 2 genotype of the donor affects kidney graft function." Pharmacogenet Genomics. 19(4):276-288. PMID:19214140
  7. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  8. [ + ] Rodriguez-Novoa S, et al. (2009) "Predictors of kidney tubular dysfunction in HIV-infected patients treated with tenofovir: a pharmacogenetic study." Clin Infect Dis. 48(11):e108-e116. PMID:19400747
  9. [ + ] Miura M, et al. (2009) "Telmisartan pharmacokinetics in Japanese renal transplant recipients." Clin Chim Acta. 399(1-2):83-87. PMID:18838068
  10. [ + ] Fanta S, et al. (2008) "Pharmacogenetics of cyclosporine in children suggests an age-dependent influence of ABCB1 polymorphisms." Pharmacogenet Genomics. 18(2):77-90. PMID:18192894
  11. [ + ] Bandler PE, et al. (2008) "Identification of regions required for apical membrane localization of human multidrug resistance protein 2." Mol Pharmacol. 74(1):9-19. PMID:18381564
  12. [ + ] Fujita K, et al. (2008) "Association of ATP-binding cassette, sub-family C, number 2 (ABCC2) genotype with pharmacokinetics of irinotecan in Japanese patients with metastatic colorectal cancer treated with irinotecan plus infusional 5-fluorouracil/leucovorin (FOLFIRI)." Biol Pharm Bull. 31(11):2137-2142. PMID:18981587
  13. [ + ] Ho WF, et al. (2008) "Genetic variations of the ABCC2 gene in the Chinese, Malay, and Indian populations of Singapore." Drug Metab Pharmacokinet. 23(5):385-391. PMID:18974617
  14. [ + ] Zimmermann C, et al. (2008) "Species-dependent transport and modulation properties of human and mouse multidrug resistance protein 2 (MRP2/Mrp2, ABCC2/Abcc2)." Drug Metab Dispos. 36(4):631-640. PMID:18180270
  15. [ + ] Sookoian S, et al. (2008) "Polymorphisms of MRP2 (ABCC2) are associated with susceptibility to nonalcoholic fatty liver disease." J Nutr Biochem. ():. PMID:18926681
  16. [ + ] Han JY, et al. (2008) "Integrated pharmacogenetic prediction of irinotecan pharmacokinetics and toxicity in patients with advanced non-small cell lung cancer." Lung Cancer. ():. PMID:18221820
  17. [ + ] Gradilone A, et al. (2008) "Celecoxib upregulates multidrug resistance proteins in colon cancer: lack of synergy with standard chemotherapy." Curr Cancer Drug Targets. 8(5):414-420. PMID:18690847
  18. [ + ] Kamata S, et al. (2008) "Expression and localization of ATP binding cassette (ABC) family of drug transporters in gastric hepatoid adenocarcinomas." Histopathology. 52(6):747-754. PMID:18439156
  19. [ + ] Kuypers DR, et al. (2008) "Current target ranges of mycophenolic acid exposure and drug-related adverse events: a 5-year, open-label, prospective, clinical follow-up study in renal allograft recipients." Clin Ther. 30(4):673-683. PMID:18498916
  20. [ + ] Haenisch S, et al. (2008) "Influence of genetic polymorphisms on intestinal expression and rifampicin-type induction of ABCC2 and on bioavailability of talinolol." Pharmacogenet Genomics. 18(4):357-365. PMID:18334920
  21. [ + ] Ranganathan P, et al. (2008) "Methotrexate (MTX) pathway gene polymorphisms and their effects on MTX toxicity in Caucasian and African American patients with rheumatoid arthritis." J Rheumatol. 35(4):572-579. PMID:18381794
  22. [ + ] Kiyotani K, et al. (2008) "Association of genetic polymorphisms in SLCO1B3 and ABCC2 with docetaxel-induced leukopenia." Cancer Sci. 99(5):967-972. PMID:18294295
  23. [ + ] Baker S, et al. (2008) "Pharmacogenetic Pathway Analysis of Docetaxel Elimination." Clin Pharmacol Ther. ():. PMID:18509327
  24. [ + ] Miura M, et al. (2008) "Influence of Drug Transporters and UGT Polymorphisms on Pharmacokinetics of Phenolic glucuronide Metabolite of Mycophenolic Acid in Japanese Renal Transplant Recipients." Ther Drug Monit. ():. PMID:18695635
  25. [ + ] Hesselink DA, et al. (2008) "A drug transporter for all ages? ABCB1 and the developmental pharmacogenetics of cyclosporine." Pharmacogenomics. 9(6):783-789. PMID:18518855
  26. [ + ] Zhang WX, et al. (2008) "Influence of uridine diphosphate (UDP)-glucuronosyltransferases and ABCC2 genetic polymorphisms on the pharmacokinetics of mycophenolic acid and its metabolites in Chinese renal transplant recipients." Xenobiotica. 38(11):1422-1436. PMID:18946804
  27. [ + ] Meier Y, et al. (2008) "Increased susceptibility for intrahepatic cholestasis of pregnancy and contraceptive-induced cholestasis in carriers of the 1331T>C polymorphism in the bile salt export pump." World J Gastroenterol. 14(1):38-45. PMID:18176959
  28. [ + ] Ito K, et al. (2008) "Cholesterol but not association with detergent resistant membranes is necessary for the transport function of MRP2/ABCC2." FEBS Lett. 582(30):4153-4157. PMID:19038257
  29. [ + ] Seo T, et al. (2008) "ABCC2 haplotype is not associated with drug-resistant epilepsy." J Pharm Pharmacol. 60(5):631-635. PMID:18416940
  30. [ + ] Levesque E, et al. (2008) "Pharmacokinetics of mycophenolate mofetil and its glucuronide metabolites in healthy volunteers." Pharmacogenomics. 9(7):869-879. PMID:18597651
  31. [ + ] Petria A, et al. (2008) "Quiz HQ 45. A rare case of conjugated hyperbilirubinemia. Dubin-Johnson syndrome." J Gastrointestin Liver Dis. 17(2):199, 216. PMID:18697280
  32. [ + ] Kojima H, et al. (2008) "Disturbed colocalization of multidrug resistance protein 2 and radixin in human cholestatic liver diseases." J Gastroenterol Hepatol. 23(7 Pt 2):e120-e128. PMID:17725603
  33. [ + ] Pazos M, et al. (2008) "Multidrug resistance-associated transporter 2 regulates mucosal inflammation by facilitating the synthesis of hepoxilin A3." J Immunol. 181(11):8044-8052. PMID:19017997
  34. [ + ] Sai K, et al. (2008) "Genetic variations and haplotypes of ABCC2 encoding MRP2 in a Japanese population." Drug Metab Pharmacokinet. 23(2):139-147. PMID:18445995
  35. [ + ] Sookoian S, et al. (2008) "Association of the multidrug-resistance-associated protein gene (ABCC2) variants with intrahepatic cholestasis of pregnancy." J Hepatol. 48(1):125-132. PMID:17997497
  36. [ + ] Hosgood HD 3rd, et al. (2008) "Pathway-based evaluation of 380 candidate genes and lung cancer susceptibility suggests the importance of the cell cycle pathway." Carcinogenesis. 29(10):1938-1943. PMID:18676680
  37. [ + ] Mori Y, et al. (2008) "[Single nucleotide polymorphism analysis in the GSTP1 and ABCC2 genes about neuropathy by the Oxaliplatin]" Gan To Kagaku Ryoho. 35(13):2377-2381. PMID:19098406
  38. [ + ] Noma B, et al. (2008) "Expression of multidrug resistance-associated protein 2 is involved in chemotherapy resistance in human pancreatic cancer." Int J Oncol. 33(6):1187-1194. PMID:19020751
  39. [ + ] Lu MC, et al. (2008) "Increased multidrug resistance-associated protein activity in mononuclear cells of patients with systemic lupus erythematosus." Clin Exp Rheumatol. 26(4):638-645. PMID:18799096
  40. [ + ] Ho RH, et al. (2007) "Effect of drug transporter genotypes on pravastatin disposition in European- and African-American participants." Pharmacogenet Genomics. 17(8):647-656. PMID:17622941
  41. [ + ] Adachi T, et al. (2007) "Nrf2-dependent and -independent induction of ABC transporters ABCC1, ABCC2, and ABCG2 in HepG2 cells under oxidative stress." J Exp Ther Oncol. 6(4):335-348. PMID:18038766
  42. [ + ] Filipits M, et al. (2007) "Multidrug resistance proteins do not predict benefit of adjuvant chemotherapy in patients with completely resected non-small cell lung cancer: International Adjuvant Lung Cancer Trial Biologic Program." Clin Cancer Res. 13(13):3892-3898. PMID:17606722
  43. [ + ] Choi JH, et al. (2007) "MRP2 haplotypes confer differential susceptibility to toxic liver injury." Pharmacogenet Genomics. 17(6):403-415. PMID:17502832
  44. [ + ] Han JY, et al. (2007) "Associations of ABCB1, ABCC2, and ABCG2 polymorphisms with irinotecan-pharmacokinetics and clinical outcome in patients with advanced non-small cell lung cancer." Cancer. 110(1):138-147. PMID:17534875
  45. [ + ] de Jong FA, et al. (2007) "Irinotecan-induced diarrhea: functional significance of the polymorphic ABCC2 transporter protein." Clin Pharmacol Ther. 81(1):42-49. PMID:17185998
  46. [ + ] Nozaki Y, et al. (2007) "Species difference in the inhibitory effect of nonsteroidal anti-inflammatory drugs on the uptake of methotrexate by human kidney slices." J Pharmacol Exp Ther. 322(3):1162-1170. PMID:17578901
  47. [ + ] Hrebicek M, et al. (2007) "Rotor-type hyperbilirubinaemia has no defect in the canalicular bilirubin export pump." Liver Int. 27(4):485-491. PMID:17403188
  48. [ + ] Williamson G, et al. (2007) "Interaction of positional isomers of quercetin glucuronides with the transporter ABCC2 (cMOAT, MRP2)." Drug Metab Dispos. 35(8):1262-1268. PMID:17478601
  49. [ + ] Mor-Cohen R, et al. (2007) "Age estimates of ancestral mutations causing factor VII deficiency and Dubin-Johnson syndrome in Iranian and Moroccan Jews are consistent with ancient Jewish migrations." Blood Coagul Fibrinolysis. 18(2):139-144. PMID:17287630