Abcc5 | GeneID:116721 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 116721 Official Symbol Abcc5
Locus N/A Gene Type protein-coding
Synonyms Abcc5a; MGC156604; Mrp5
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Chromosome 11q23
Also Known As ATP-binding cassette sub-family C (CFTR/MRP) member 5a; ATP-binding cassette, sub-family C (CFTR/MRP), member 5a
Summary ATP-binding cassette (ABC) multiple drug resistance protein that mediates efflux cGMP during nitric oxide-induced regulation of smooth muscle [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21164

ID Symbol Protein Species
GeneID:10057 ABCC5 NP_005679.2 Homo sapiens
GeneID:27416 Abcc5 NP_038818.2 Mus musculus
GeneID:116721 Abcc5 NP_446376.1 Rattus norvegicus
GeneID:181587 mrp-5 NP_510479.1 Caenorhabditis elegans
GeneID:424947 ABCC5 XP_422754.2 Gallus gallus
GeneID:478648 ABCC5 XP_857354.1 Canis lupus familiaris
GeneID:511769 ABCC5 XP_001251891.1 Bos taurus
GeneID:796249 LOC796249 XP_001333981.2 Danio rerio
GeneID:4329047 Os02g0288400 NP_001046583.1 Oryza sativa
GeneID:4329049 Os02g0288700 NP_001046585.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab24107 MRP5 antibody [M5II-54] (ab24107); Rat monoclonal [M5II-54] to MRP5

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0048471 Component perinuclear region of cytoplasm
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0003674 Function molecular_function
GO:0000166 Function nucleotide binding
GO:0032868 Process response to insulin stimulus
GO:0032496 Process response to lipopolysaccharide
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_053924  UCSC Browser NP_446376

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000002316 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENSRNOT00000002316 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENSRNOT00000002316 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSRNOT00000002316 MI0001734 mmu-miR-452 UGUUUGCAGAGGAAACUGAGAC
ENSRNOT00000002316 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSRNOT00000002316 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENSRNOT00000002316 MI0000832 rno-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENSRNOT00000002316 MI0000904 rno-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSRNOT00000002316 MI0000960 rno-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Schafer C, et al. (2007) "Modulation of gene expression profiles by hyperosmolarity and insulin." Cell Physiol Biochem. 20(5):369-386. PMID:17762165
  2. [ + ] Dazert P, et al. (2006) "Differential regulation of transport proteins in the periinfarct region following reversible middle cerebral artery occlusion in rats." Neuroscience. 142(4):1071-1079. PMID:16997484
  3. [ + ] Andric SA, et al. (2006) "Contribution of multidrug resistance protein MRP5 in control of cyclic guanosine 5'-monophosphate intracellular signaling in anterior pituitary cells." Endocrinology. 147(7):3435-3445. PMID:16614078
  4. [ + ] Donner MG, et al. (2004) "Enhanced expression of basolateral multidrug resistance protein isoforms Mrp3 and Mrp5 in rat liver by LPS." Biol Chem. 385(3-4):331-339. PMID:15134348
  5. [ + ] Xu HL, et al. (2004) "Regulation of rat pial arteriolar smooth muscle relaxation in vivo through multidrug resistance protein 5-mediated cGMP efflux." Am J Physiol Heart Circ Physiol. 286(5):H2020-H2027. PMID:14715514
  6. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  7. [ + ] Jedlitschky G, et al. (2000) "The multidrug resistance protein 5 functions as an ATP-dependent export pump for cyclic nucleotides." J Biol Chem. 275(39):30069-30074. PMID:10893247