ABHD15 | GeneID:116236 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 116236 Official Symbol ABHD15
Locus N/A Gene Type protein-coding
Synonyms
Full Name abhydrolase domain containing 15
Description abhydrolase domain containing 15
Chromosome 17q11.2
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 12142

ID Symbol Protein Species
GeneID:67477 1300007F04Rik NP_080461.2 Mus musculus
GeneID:116236 LOC116236 NP_937790.1 Homo sapiens
GeneID:303343 RGD1304598 XP_220745.3 Rattus norvegicus
GeneID:468200 LOC468200 XP_523591.2 Pan troglodytes
GeneID:491179 LOC491179 XP_548299.2 Canis lupus familiaris
GeneID:528755 LOC528755 XP_607187.3 Bos taurus
GeneID:560644 LOC560644 XP_689131.2 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma HPA014470 Anti-AC104564.11 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABHD15 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABHD15 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_198147  UCSC Browser NP_937790

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000307201 MI0001519 hsa-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENST00000307201 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENST00000307201 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENST00000307201 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000307201 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000307201 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENST00000307201 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENST00000307201 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  2. [ + ] Clark HF, et al. (2003) "The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment." Genome Res. 13(10):2265-2270. PMID:12975309
  3. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932