Acan | GeneID:11595 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 11595 Official Symbol Acan
Locus N/A Gene Type protein-coding
Synonyms Agc; Agc1; Cspg1; cmd
Full Name aggrecan
Description aggrecan
Chromosome 7 D3|7 39.0 cM
Also Known As aggrecan 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 7227

ID Symbol Protein Species
GeneID:11595 Acan NP_031450.2 Mus musculus
GeneID:58968 Acan NP_071526.1 Rattus norvegicus
GeneID:280985 ACAN NP_776406.1 Bos taurus
GeneID:395798 ACAN XP_001232950.1 Gallus gallus
GeneID:403828 ACAN XP_536187.1 Canis lupus familiaris
GeneID:497505 agc1 XP_686182.3 Danio rerio
GeneID:559593 LOC559593 XP_688042.3 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab36861 Aggrecan antibody (ab36861); Rabbit polyclonal to Aggrecan
2 abcam ab16320 Aggrecan antibody (ab16320); Rabbit polyclonal to Aggrecan
3 sigma C8035 Monoclonal Anti-Chondroitin Sulfate antibody produced in mouse ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005604 Component basement membrane
GO:0031012 Component extracellular matrix
GO:0005576 Component extracellular region
GO:0005578 Component proteinaceous extracellular matrix
GO:0005488 Function binding
GO:0005540 Function hyaluronic acid binding
GO:0005515 Function protein binding
GO:0005529 Function sugar binding
GO:0001502 Process cartilage condensation
GO:0007155 Process cell adhesion
GO:0002063 Process chondrocyte development
GO:0030199 Process collagen fibril organization
GO:0030166 Process proteoglycan biosynthetic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_007424  UCSC Browser NP_031450

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000032835 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSMUST00000032835 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSMUST00000032835 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSMUST00000032835 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENSMUST00000032835 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENSMUST00000032835 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSMUST00000032835 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSMUST00000032835 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENSMUST00000032835 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENSMUST00000032835 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSMUST00000032835 MI0000150 mmu-miR-124 UAAGGCACGCGGUGAAUGCC
ENSMUST00000032835 MI0000716 mmu-miR-124 UAAGGCACGCGGUGAAUGCC
ENSMUST00000032835 MI0000717 mmu-miR-124 UAAGGCACGCGGUGAAUGCC
ENSMUST00000032835 MI0000230 mmu-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENSMUST00000032835 MI0000231 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000032835 MI0000572 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000032835 MI0000578 mmu-miR-27a* AGGGCUUAGCUGCUUGUGAGCA
ENSMUST00000032835 MI0000399 mmu-miR-299 UAUGUGGGACGGUAAACCGCUU
ENSMUST00000032835 MI0000145 mmu-miR-30b* CUGGGAUGUGGAUGUUUACGUC
ENSMUST00000032835 MI0000579 mmu-miR-31 AGGCAAGAUGCUGGCAUAGCUG
ENSMUST00000032835 MI0000607 mmu-miR-330 UCUCUGGGCCUGUGUCUUAGGC
ENSMUST00000032835 MI0000797 mmu-miR-380-3p UAUGUAGUAUGGUCCACAUCUU
ENSMUST00000032835 MI0001525 mmu-miR-433* UACGGUGAGCCUGUCAUUAUUC
ENSMUST00000032835 MI0004123 mmu-miR-675-5p UGGUGCGGAAAGGGCCCACAGU
ENSMUST00000032835 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSMUST00000032835 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENSMUST00000032835 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSMUST00000032835 MI0005480 mmu-miR-876-5p UGGAUUUCUCUGUGAAUCACUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AK132351   L07049   L07051   NM_007424   X80279  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Retting KN, et al. (2009) "BMP canonical Smad signaling through Smad1 and Smad5 is required for endochondral bone formation." Development. 136(7):1093-1104. PMID:19224984
  2. [ + ] Rokutanda S, et al. (2009) "Akt regulates skeletal development through GSK3, mTOR, and FoxOs." Dev Biol. 328(1):78-93. PMID:19389373
  3. [ + ] Shibata S, et al. (2008) "An in situ hybridization study of Runx2, Osterix, and Sox9 in the anlagen of mouse mandibular condylar cartilage in the early stages of embryogenesis." J Anat. 213(3):274-283. PMID:18624832
  4. [ + ] Shay EL, et al. (2008) "Dynamic expression patterns of ECM molecules in the developing mouse olfactory pathway." Dev Dyn. 237(7):1837-1850. PMID:18570250
  5. [ + ] Sohaskey ML, et al. (2008) "JAWS coordinates chondrogenesis and synovial joint positioning." Development. 135(13):2215-2220. PMID:18539921
  6. [ + ] Liu W, et al. (2008) "Coordinated molecular control of otic capsule differentiation: functional role of Wnt5a signaling and opposition by sfrp3 activity." Growth Factors. 26(6):343-354. PMID:18991062
  7. [ + ] Han Y, et al. (2008) "L-Sox5 and Sox6 drive expression of the aggrecan gene in cartilage by securing binding of Sox9 to a far-upstream enhancer." Mol Cell Biol. 28(16):4999-5013. PMID:18559420
  8. [ + ] Hwang CH, et al. (2008) "Noggin heterozygous mice: an animal model for congenital conductive hearing loss in humans." Hum Mol Genet. 17(6):844-853. PMID:18096605
  9. [ + ] Snider P, et al. (2008) "Periostin is required for maturation and extracellular matrix stabilization of noncardiomyocyte lineages of the heart." Circ Res. 102(7):752-760. PMID:18296617
  10. [ + ] Inoue H, et al. (2008) "High levels of serum IL-18 promote cartilage loss through suppression of aggrecan synthesis." Bone. 42(6):1102-1110. PMID:18374640
  11. [ + ] Shinoda Y, et al. (2008) "Kruppel-like factor 5 causes cartilage degradation through transactivation of matrix metalloproteinase 9." J Biol Chem. 283(36):24682-24689. PMID:18617520
  12. [ + ] Amarilio R, et al. (2007) "HIF1alpha regulation of Sox9 is necessary to maintain differentiation of hypoxic prechondrogenic cells during early skeletogenesis." Development. 134(21):3917-3928. PMID:17913788
  13. [ + ] Haycraft CJ, et al. (2007) "Intraflagellar transport is essential for endochondral bone formation." Development. 134(2):307-316. PMID:17166921
  14. [ + ] Sakai K, et al. (2007) "Chondroitin sulfate N-acetylgalactosaminyltransferase-1 plays a critical role in chondroitin sulfate synthesis in cartilage." J Biol Chem. 282(6):4152-4161. PMID:17145758
  15. [ + ] McRae PA, et al. (2007) "Sensory deprivation alters aggrecan and perineuronal net expression in the mouse barrel cortex." J Neurosci. 27(20):5405-5413. PMID:17507562
  16. [ + ] Iwamoto M, et al. (2007) "Transcription factor ERG and joint and articular cartilage formation during mouse limb and spine skeletogenesis." Dev Biol. 305(1):40-51. PMID:17336282
  17. [ + ] Little CB, et al. (2007) "Blocking aggrecanase cleavage in the aggrecan interglobular domain abrogates cartilage erosion and promotes cartilage repair." J Clin Invest. 117(6):1627-1636. PMID:17510707
  18. [ + ] Hiraoka S, et al. (2007) "Nucleotide-sugar transporter SLC35D1 is critical to chondroitin sulfate synthesis in cartilage and skeletal development in mouse and human." Nat Med. 13(11):1363-1367. PMID:17952091
  19. [ + ] Patra D, et al. (2007) "Site-1 protease is essential for endochondral bone formation in mice." J Cell Biol. 179(4):687-700. PMID:18025304
  20. [ + ] Song B, et al. (2007) "Development of the post-natal growth plate requires intraflagellar transport proteins." Dev Biol. 305(1):202-216. PMID:17359961
  21. [ + ] Costa C, et al. (2007) "Mapping of aggrecan, hyaluronic acid, heparan sulphate proteoglycans and aquaporin 4 in the central nervous system of the mouse." J Chem Neuroanat. 33(3):111-123. PMID:17349777
  22. [ + ] Bok J, et al. (2007) "Role of hindbrain in inner ear morphogenesis: analysis of Noggin knockout mice." Dev Biol. 311(1):69-78. PMID:17900554
  23. [ + ] Imai F, et al. (2006) "Inactivation of aPKClambda results in the loss of adherens junctions in neuroepithelial cells without affecting neurogenesis in mouse neocortex." Development. 133(9):1735-1744. PMID:16571631
  24. [ + ] Ikeya M, et al. (2006) "Essential pro-Bmp roles of crossveinless 2 in mouse organogenesis." Development. 133(22):4463-4473. PMID:17035289
  25. [ + ] Wang Y, et al. (2006) "Insulin-like growth factor-I is essential for embryonic bone development." Endocrinology. 147(10):4753-4761. PMID:16857753
  26. [ + ] van der Weyden L, et al. (2006) "Functional knockout of the matrilin-3 gene causes premature chondrocyte maturation to hypertrophy and increases bone mineral density and osteoarthritis." Am J Pathol. 169(2):515-527. PMID:16877353
  27. [ + ] Matsumoto K, et al. (2006) "Identification and characterization of versican/PG-M aggregates in cartilage." J Biol Chem. 281(26):18257-18263. PMID:16648631
  28. [ + ] Barrionuevo F, et al. (2006) "Sox9 is required for notochord maintenance in mice." Dev Biol. 295(1):128-140. PMID:16678811
  29. [ + ] Buzas EI, et al. (2005) "T-cell recognition of differentially tolerated epitopes of cartilage proteoglycan aggrecan in arthritis." Cell Immunol. 235(2):98-108. PMID:16185673
  30. [ + ] Rhee DK, et al. (2005) "The secreted glycoprotein lubricin protects cartilage surfaces and inhibits synovial cell overgrowth." J Clin Invest. 115(3):622-631. PMID:15719068
  31. [ + ] Kluppel M, et al. (2005) "Maintenance of chondroitin sulfation balance by chondroitin-4-sulfotransferase 1 is required for chondrocyte development and growth factor signaling during cartilage morphogenesis." Development. 132(17):3989-4003. PMID:16079159
  32. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  33. [ + ] Lee NV, et al. (2005) "Fibulin-1 acts as a cofactor for the matrix metalloprotease ADAMTS-1." J Biol Chem. 280(41):34796-34804. PMID:16061471
  34. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  35. [ + ] Tamamura Y, et al. (2005) "Developmental regulation of Wnt/beta-catenin signals is required for growth plate assembly, cartilage integrity, and endochondral ossification." J Biol Chem. 280(19):19185-19195. PMID:15760903
  36. [ + ] Yoon BS, et al. (2005) "Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo." Proc Natl Acad Sci U S A. 102(14):5062-5067. PMID:15781876
  37. [ + ] McGlinn E, et al. (2005) "Pax9 and Jagged1 act downstream of Gli3 in vertebrate limb development." Mech Dev. 122(11):1218-1233. PMID:16169709
  38. [ + ] Little CB, et al. (2005) "Matrix metalloproteinases are not essential for aggrecan turnover during normal skeletal growth and development." Mol Cell Biol. 25(8):3388-3399. PMID:15798221
  39. [ + ] Ko Y, et al. (2004) "Matrilin-3 is dispensable for mouse skeletal growth and development." Mol Cell Biol. 24(4):1691-1699. PMID:14749384
  40. [ + ] Yeh LC, et al. (2004) "Identification of an osteogenic protein-1 responsive element in the aggrecan promoter." Biochem Biophys Res Commun. 323(1):223-228. PMID:15351725
  41. [ + ] Smits P, et al. (2004) "Sox5 and Sox6 are needed to develop and maintain source, columnar, and hypertrophic chondrocytes in the cartilage growth plate." J Cell Biol. 164(5):747-758. PMID:14993235
  42. [ + ] Mates L, et al. (2004) "Mice lacking the extracellular matrix adaptor protein matrilin-2 develop without obvious abnormalities." Matrix Biol. 23(3):195-204. PMID:15296947
  43. [ + ] Ficker M, et al. (2004) "Analysis of genes from inner ear developmental-stage cDNA subtraction reveals molecular regionalization of the otic capsule." Dev Biol. 268(1):7-23. PMID:15031101
  44. [ + ] Savontaus M, et al. (2004) "Abnormal craniofacial development and expression patterns of extracellular matrix components in transgenic Del1 mice harboring a deletion mutation in the type II collagen gene." Orthod Craniofac Res. 7(4):216-226. PMID:15562585
  45. [ + ] Hikake T, et al. (2003) "Comparison of expression patterns between CREB family transcription factor OASIS and proteoglycan core protein genes during murine tooth development." Anat Embryol (Berl). 206(5):373-380. PMID:12684764
  46. [ + ] Smits P, et al. (2003) "Sox5 and Sox6 are required for notochord extracellular matrix sheath formation, notochord cell survival and development of the nucleus pulposus of intervertebral discs." Development. 130(6):1135-1148. PMID:12571105
  47. [ + ] Ivkovic S, et al. (2003) "Connective tissue growth factor coordinates chondrogenesis and angiogenesis during skeletal development." Development. 130(12):2779-2791. PMID:12736220
  48. [ + ] Puttaparthi K, et al. (2003) "Aggregate formation in the spinal cord of mutant SOD1 transgenic mice is reversible and mediated by proteasomes." J Neurochem. 87(4):851-860. PMID:14622116
  49. [ + ] Shibata S, et al. (2003) "In situ hybridization and immunohistochemistry of versican, aggrecan and link protein, and histochemistry of hyaluronan in the developing mouse limb bud cartilage." J Anat. 203(4):425-432. PMID:14620382