ache | GeneID:114549 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 114549 Official Symbol ache
Locus N/A Gene Type protein-coding
Synonyms zgc:92550
Full Name acetylcholinesterase
Description acetylcholinesterase
Chromosome N/A
Also Known As ziehharmonika; zim
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 543

ID Symbol Protein Species
GeneID:43 ACHE NP_000656.1 Homo sapiens
GeneID:11423 Ache NP_033729.1 Mus musculus
GeneID:114549 ache NP_571921.1 Danio rerio
GeneID:181706 ace-1 NP_510660.1 Caenorhabditis elegans
GeneID:489828 ACHE XP_546946.2 Canis lupus familiaris
GeneID:540446 ACHE NP_001069688.1 Bos taurus
GeneID:1281827 ACE1 XP_321792.1 Anopheles gambiae
GeneID:2681253 MGG_02130 XP_365428.1 Magnaporthe grisea

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030054 Component cell junction
GO:0005576 Component extracellular region
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0045202 Component synapse
GO:0003990 Function acetylcholinesterase activity
GO:0004091 Function carboxylesterase activity
GO:0004104 Function cholinesterase activity
GO:0016787 Function hydrolase activity
GO:0006581 Process acetylcholine catabolic process
GO:0030239 Process myofibril assembly
GO:0007528 Process neuromuscular junction development
GO:0048666 Process neuron development
GO:0042135 Process neurotransmitter catabolic process
GO:0050803 Process regulation of synapse structure and activity
GO:0001975 Process response to amphetamine
GO:0042221 Process response to chemical stimulus
GO:0045471 Process response to ethanol

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_131846 NP_571921 B3DKL4   Q9DDE3  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000052989 MI0001857 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000052989 MI0001858 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000052989 MI0001860 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000052989 MI0001861 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000052989 MI0001862 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000052989 MI0001863 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000052989 MI0001871 dre-let-7e UGAGGUAGUAGAUUGAAUAGUU
ENSDART00000052989 MI0001872 dre-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSDART00000052989 MI0001873 dre-let-7g UGAGGUAGUAGUUUGUAUAGUU
ENSDART00000052989 MI0001874 dre-let-7g UGAGGUAGUAGUUUGUAUAGUU
ENSDART00000052989 MI0001876 dre-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSDART00000052989 MI0003343 dre-let-7j UGAGGUAGUUGUUUGUACAGUU
ENSDART00000052989 MI0001984 dre-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSDART00000052989 MI0001985 dre-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSDART00000052989 MI0001986 dre-miR-130b CAGUGCAAUAAUGAAAGGGCAU
ENSDART00000052989 MI0001987 dre-miR-130c CAGUGCAAUAUUAAAAGGGCAU
ENSDART00000052989 MI0001988 dre-miR-130c CAGUGCAAUAUUAAAAGGGCAU
ENSDART00000052989 MI0001989 dre-miR-132* ACCGUGGCAUUAGAUUGUUACU
ENSDART00000052989 MI0003692 dre-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSDART00000052989 MI0003364 dre-miR-135b UAUGGCUUUUUAUUCCUAUCUG
ENSDART00000052989 MI0001996 dre-miR-135c UAUGGCUUUCUAUUCCUAUGUG
ENSDART00000052989 MI0001997 dre-miR-135c UAUGGCUUUCUAUUCCUAUGUG
ENSDART00000052989 MI0001998 dre-miR-135c UAUGGCUUUCUAUUCCUAUGUG
ENSDART00000052989 MI0002003 dre-miR-140* UACCACAGGGUAGAACCACGGAC
ENSDART00000052989 MI0002029 dre-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSDART00000052989 MI0002030 dre-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSDART00000052989 MI0002031 dre-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSDART00000052989 MI0002032 dre-miR-193b AACUGGCCCGCAAAGUCCCGCU
ENSDART00000052989 MI0002041 dre-miR-203b* AGUGGUUCUCAACAGUUCAACA
ENSDART00000052989 MI0001377 dre-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSDART00000052989 MI0002042 dre-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSDART00000052989 MI0002043 dre-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSDART00000052989 MI0002048 dre-miR-216b UAAUCUCUGCAGGCAACUGUGA
ENSDART00000052989 MI0002049 dre-miR-216b UAAUCUCUGCAGGCAACUGUGA
ENSDART00000052989 MI0002074 dre-miR-454a UAGUGCAAUAUUGCUAAUAGGG
ENSDART00000052989 MI0002076 dre-miR-454b UAGUGCAAUAUUGCUUAUAGGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Rico EP, et al. (2007) "Ethanol alters acetylcholinesterase activity and gene expression in zebrafish brain." Toxicol Lett. 174(1-3):25-30. PMID:17888594
  2. [ + ] Lin CC, et al. (2007) "Toxicity and cardiac effects of carbaryl in early developing zebrafish (Danio rerio) embryos." Toxicol Appl Pharmacol. 222(2):159-168. PMID:17559897
  3. [ + ] Ninkovic J, et al. (2006) "Genetic identification of AChE as a positive modulator of addiction to the psychostimulant D-amphetamine in zebrafish." J Neurobiol. 66(5):463-475. PMID:16470869
  4. [ + ] van der Ven K, et al. (2006) "Neuropharmaceuticals in the environment: mianserin-induced neuroendocrine disruption in zebrafish (Danio rerio) using cDNA microarrays." Environ Toxicol Chem. 25(10):2645-2652. PMID:17022405
  5. [ + ] Rico EP, et al. (2006) "Methanol alters ecto-nucleotidases and acetylcholinesterase in zebrafish brain." Neurotoxicol Teratol. 28(4):489-496. PMID:16806813
  6. [ + ] Kuster E, et al. (2005) "Cholin- and carboxylesterase activities in developing zebrafish embryos (Danio rerio) and their potential use for insecticide hazard assessment." Aquat Toxicol. 75(1):76-85. PMID:16112210
  7. [ + ] Allebrandt KV, et al. (2005) "Expression of acetylcholinesterase (AChE) and aryl acylamidase (AAA) during early zebrafish embryogenesis." Chem Biol Interact. 157-158():353-355. PMID:16425445
  8. [ + ] Downes GB, et al. (2004) "Acetylcholinesterase function is dispensable for sensory neurite growth but is critical for neuromuscular synapse stability." Dev Biol. 270(1):232-245. PMID:15136152
  9. [ + ] Lewis KE, et al. (2003) "From cells to circuits: development of the zebrafish spinal cord." Prog Neurobiol. 69(6):419-449. PMID:12880634
  10. [ + ] Roex EW, et al. (2003) "Acetylcholinesterase inhibition and increased food consumption rate in the zebrafish, Danio rerio, after chronic exposure to parathion." Aquat Toxicol. 64(4):451-460. PMID:12878415
  11. [ + ] Behra M, et al. (2002) "Acetylcholinesterase is required for neuronal and muscular development in the zebrafish embryo." Nat Neurosci. 5(2):111-118. PMID:11753420
  12. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  13. [ + ] Bertrand C, et al. (2001) "Zebrafish acetylcholinesterase is encoded by a single gene localized on linkage group 7. Gene structure and polymorphism; molecular forms and expression pattern during development." J Biol Chem. 276(1):464-474. PMID:11016933