Aatf | GeneID:114512 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 114512 Official Symbol Aatf
Locus N/A Gene Type protein-coding
Synonyms Ded
Full Name apoptosis antagonizing transcription factor
Description apoptosis antagonizing transcription factor
Chromosome 10q26
Also Known As
Summary an apoptosis antagonizing nuclear phosphoprotein transcription factor [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 40811

ID Symbol Protein Species
GeneID:26574 AATF NP_036270.1 Homo sapiens
GeneID:33943 CG11188 NP_609066.1 Drosophila melanogaster
GeneID:56321 Aatf NP_062790.1 Mus musculus
GeneID:114512 Aatf NP_446172.1 Rattus norvegicus
GeneID:171723 Y73E7A.2 NP_490870.2 Caenorhabditis elegans
GeneID:417653 AATF NP_001025895.1 Gallus gallus
GeneID:454601 AATF XP_511427.2 Pan troglodytes
GeneID:480595 AATF XP_537715.2 Canis lupus familiaris
GeneID:559477 aatf NP_001077297.1 Danio rerio
GeneID:786013 AATF XP_001252958.1 Bos taurus
GeneID:836254 AT5G61330 NP_200941.2 Arabidopsis thaliana
GeneID:851893 BFR2 NP_010585.1 Saccharomyces cerevisiae
GeneID:1269788 AgaP_AGAP007394 XP_308438.2 Anopheles gambiae
GeneID:2543540 SPAC664.08c NP_593456.1 Schizosaccharomyces pombe
GeneID:2677840 MGG_04641 XP_362196.2 Magnaporthe grisea
GeneID:2706053 NCU04787.1 XP_324144.1 Neurospora crassa
GeneID:2892016 KLLA0C10362g XP_452661.1 Kluyveromyces lactis
GeneID:4323936 Os01g0526200 NP_001043227.1 Oryza sativa
GeneID:4618523 AGOS_AAL064W NP_982478.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab65248 AATF antibody (ab65248); Rabbit polyclonal to AATF
2 abcam ab66649 AATF antibody (ab66649); Rabbit polyclonal to AATF

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030054 Component cell junction
GO:0005813 Component centrosome
GO:0005737 Component cytoplasm
GO:0005925 Component focal adhesion
GO:0005794 Component Golgi apparatus
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0005515 Function protein binding
GO:0019904 Function protein domain specific binding
GO:0048156 Function tau protein binding
GO:0003700 Function transcription factor activity
GO:0006915 Process apoptosis
GO:0007155 Process cell adhesion
GO:0040016 Process embryonic cleavage
GO:0042985 Process negative regulation of amyloid precursor protein biosynthetic process
GO:0045941 Process positive regulation of transcription
GO:0007346 Process regulation of mitotic cell cycle
GO:0042254 Process ribosome biogenesis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_053720  UCSC Browser NP_446172

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000000258 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENSRNOT00000000258 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENSRNOT00000000258 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA
ENSRNOT00000000258 MI0000915 rno-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENSRNOT00000000258 MI0000843 rno-miR-15b UAGCAGCACAUCAUGGUUUACA
ENSRNOT00000000258 MI0000844 rno-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENSRNOT00000000258 MI0000936 rno-miR-193* UGGGUCUUUGCGGGCAAGAUGA
ENSRNOT00000000258 MI0000939 rno-miR-195 UAGCAGCACAGAAAUAUUGGC
ENSRNOT00000000258 MI0000954 rno-miR-214 ACAGCAGGCACAGACAGGCAG
ENSRNOT00000000258 MI0000589 rno-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENSRNOT00000000258 MI0003724 rno-miR-497 CAGCAGCACACUGUGGUUUGUA
ENSRNOT00000000258 MI0003555 rno-miR-503 UAGCAGCGGGAACAGUACUGCAG
ENSRNOT00000000258 MI0006157 rno-miR-672 UGAGGUUGGUGUACUGUGUGUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
Dapk3 Dapk3 / Aatf Reconstituted Complex Page G (1999)
Dapk3 Dapk3 / Aatf Two-hybrid Page G (1999)
Dapk3 Dapk3 / Aatf Two-hybrid Page G (1999)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Felten A, et al. (2007) "Characterization of rat BLOS2/Ceap, a putative yeast She3 homolog, as interaction partner of apoptosis antagonizing transcription factor/Che-1." Biol Chem. 388(6):569-582. PMID:17552904
  2. [ + ] Burgdorf S, et al. (2004) "TSG101 interacts with apoptosis-antagonizing transcription factor and enhances androgen receptor-mediated transcription by promoting its monoubiquitination." J Biol Chem. 279(17):17524-17534. PMID:14761944
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Barbato C, et al. (2003) "Rb binding protein Che-1 interacts with Tau in cerebellar granule neurons. Modulation during neuronal apoptosis." Mol Cell Neurosci. 24(4):1038-1050. PMID:14697667
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Page G, et al. (1999) "AATF, a novel transcription factor that interacts with Dlk/ZIP kinase and interferes with apoptosis." FEBS Lett. 462(1-2):187-191. PMID:10580117
  7. [ + ] Page G, et al. (1999) "Interaction partners of Dlk/ZIP kinase: co-expression of Dlk/ZIP kinase and Par-4 results in cytoplasmic retention and apoptosis." Oncogene. 18(51):7265-7273. PMID:10602480