Accn2 | GeneID:11419 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 11419 Official Symbol Accn2
Locus N/A Gene Type protein-coding
Synonyms AI843610; ASIC; ASIC1; ASIC1a; B530003N02Rik; BNaC2
Full Name amiloride-sensitive cation channel 2, neuronal
Description amiloride-sensitive cation channel 2, neuronal
Chromosome 15 F3
Also Known As acid sensing ion channel; degenerin 2
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37440

ID Symbol Protein Species
GeneID:41 ACCN2 NP_001086.2 Homo sapiens
GeneID:11419 Accn2 NP_033727.1 Mus musculus
GeneID:79123 Accn2 NP_077068.1 Rattus norvegicus
GeneID:171992 C24G7.4 NP_491293.1 Caenorhabditis elegans
GeneID:181468 flr-1 NP_510243.1 Caenorhabditis elegans
GeneID:182851 C24G7.1 NP_491296.1 Caenorhabditis elegans
GeneID:182852 C24G7.2 NP_491295.2 Caenorhabditis elegans
GeneID:182963 tag-324 NP_510463.2 Caenorhabditis elegans
GeneID:184882 F23B2.3 NP_501590.2 Caenorhabditis elegans
GeneID:185036 F28A12.1 NP_505230.1 Caenorhabditis elegans
GeneID:189051 T28F2.7 NP_491196.2 Caenorhabditis elegans
GeneID:407670 accn2c NP_999954.1 Danio rerio
GeneID:426883 ACCN2 NP_001035557.1 Gallus gallus
GeneID:451888 ACCN2 XP_001155207.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma S7944 Anti-Sodium Channel ASIC1 antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0043198 Component dendritic shaft
GO:0043197 Component dendritic spine
GO:0016021 Component integral to membrane
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0045202 Component synapse
GO:0019717 Component synaptosome
GO:0015280 Function amiloride-sensitive sodium channel activity
GO:0005509 Function calcium ion binding
GO:0005261 Function cation channel activity
GO:0005216 Function ion channel activity
GO:0015077 Function monovalent inorganic cation transmembrane transporter activity
GO:0005272 Function sodium channel activity
GO:0031402 Function sodium ion binding
GO:0008306 Process associative learning
GO:0006816 Process calcium ion transport
GO:0006812 Process cation transport
GO:0006811 Process ion transport
GO:0007613 Process memory
GO:0015672 Process monovalent inorganic cation transport
GO:0001101 Process response to acid
GO:0006814 Process sodium ion transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_009597  UCSC Browser NP_033727

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000023758 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENSMUST00000023758 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSMUST00000023758 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSMUST00000023758 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSMUST00000023758 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSMUST00000023758 MI0000151 mmu-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENSMUST00000023758 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENSMUST00000023758 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSMUST00000023758 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSMUST00000023758 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSMUST00000023758 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENSMUST00000023758 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Schnizler MK, et al. (2009) "The cytoskeletal protein alpha-actinin regulates acid-sensing ion channel 1a through a C-terminal interaction." J Biol Chem. 284(5):2697-2705. PMID:19028690
  2. [ + ] Coryell MW, et al. (2009) "Acid-sensing ion channel-1a in the amygdala, a novel therapeutic target in depression-related behavior." J Neurosci. 29(17):5381-5388. PMID:19403806
  3. [ + ] Cho JH, et al. (2008) "Presynaptic release probability is increased in hippocampal neurons from ASIC1 knockout mice." J Neurophysiol. 99(2):426-441. PMID:18094106
  4. [ + ] Ugawa S, et al. (2008) "Hypotonic stimuli enhance proton-gated currents of acid-sensing ion channel-1b." Biochem Biophys Res Commun. 367(3):530-534. PMID:18158916
  5. [ + ] Baron A, et al. (2008) "Acid sensing ion channels in dorsal spinal cord neurons." J Neurosci. 28(6):1498-1508. PMID:18256271
  6. [ + ] Ziemann AE, et al. (2008) "Seizure termination by acidosis depends on ASIC1a." Nat Neurosci. 11(7):816-822. PMID:18536711
  7. [ + ] Coryell MW, et al. (2008) "Restoring Acid-sensing ion channel-1a in the amygdala of knock-out mice rescues fear memory but not unconditioned fear responses." J Neurosci. 28(51):13738-13741. PMID:19091964
  8. [ + ] Sherwood TW, et al. (2008) "Endogenous arginine-phenylalanine-amide-related peptides alter steady-state desensitization of ASIC1a." J Biol Chem. 283(4):1818-1830. PMID:17984098
  9. [ + ] Coryell MW, et al. (2007) "Targeting ASIC1a reduces innate fear and alters neuronal activity in the fear circuit." Biol Psychiatry. 62(10):1140-1148. PMID:17662962
  10. [ + ] Hughes PA, et al. (2007) "Localization and comparative analysis of acid-sensing ion channel (ASIC1, 2, and 3) mRNA expression in mouse colonic sensory neurons within thoracolumbar dorsal root ganglia." J Comp Neurol. 500(5):863-875. PMID:17177258
  11. [ + ] Friese MA, et al. (2007) "Acid-sensing ion channel-1 contributes to axonal degeneration in autoimmune inflammation of the central nervous system." Nat Med. 13(12):1483-1489. PMID:17994101
  12. [ + ] Mazzuca M, et al. (2007) "A tarantula peptide against pain via ASIC1a channels and opioid mechanisms." Nat Neurosci. 10(8):943-945. PMID:17632507
  13. [ + ] Chai S, et al. (2007) "A kinase-anchoring protein 150 and calcineurin are involved in regulation of acid-sensing ion channels ASIC1a and ASIC2a." J Biol Chem. 282(31):22668-22677. PMID:17548344
  14. [ + ] Cho JH, et al. (2007) "Potentiation of acid-sensing ion channels by sulfhydryl compounds." Am J Physiol Cell Physiol. 292(6):C2161-C2174. PMID:17392378
  15. [ + ] Zha XM, et al. (2006) "Acid-sensing ion channel 1a is a postsynaptic proton receptor that affects the density of dendritic spines." Proc Natl Acad Sci U S A. 103(44):16556-16561. PMID:17060608
  16. [ + ] Ugawa S, et al. (2006) "Acid-sensing ion channel-1b in the stereocilia of mammalian cochlear hair cells." Neuroreport. 17(12):1235-1239. PMID:16951561
  17. [ + ] Chen CL, et al. (2006) "Runx1 determines nociceptive sensory neuron phenotype and is required for thermal and neuropathic pain." Neuron. 49(3):365-377. PMID:16446141
  18. [ + ] Vukicevic M, et al. (2006) "Trypsin cleaves acid-sensing ion channel 1a in a domain that is critical for channel gating." J Biol Chem. 281(2):714-722. PMID:16282326
  19. [ + ] Donier E, et al. (2005) "Annexin II light chain p11 promotes functional expression of acid-sensing ion channel ASIC1a." J Biol Chem. 280(46):38666-38672. PMID:16169854
  20. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  21. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  22. [ + ] Page AJ, et al. (2004) "The ion channel ASIC1 contributes to visceral but not cutaneous mechanoreceptor function." Gastroenterology. 127(6):1739-1747. PMID:15578512
  23. [ + ] Askwith CC, et al. (2004) "Acid-sensing ion channel 2 (ASIC2) modulates ASIC1 H+-activated currents in hippocampal neurons." J Biol Chem. 279(18):18296-18305. PMID:14960591
  24. [ + ] Wemmie JA, et al. (2004) "Overexpression of acid-sensing ion channel 1a in transgenic mice increases acquired fear-related behavior." Proc Natl Acad Sci U S A. 101(10):3621-3626. PMID:14988500
  25. [ + ] Drew LJ, et al. (2004) "Acid-sensing ion channels ASIC2 and ASIC3 do not contribute to mechanically activated currents in mammalian sensory neurones." J Physiol. 556(Pt 3):691-710. PMID:14990679
  26. [ + ] Wu LJ, et al. (2004) "Characterization of acid-sensing ion channels in dorsal horn neurons of rat spinal cord." J Biol Chem. 279(42):43716-43724. PMID:15302881
  27. [ + ] Xiong ZG, et al. (2004) "Neuroprotection in ischemia: blocking calcium-permeable acid-sensing ion channels." Cell. 118(6):687-698. PMID:15369669
  28. [ + ] Chu XP, et al. (2004) "Subunit-dependent high-affinity zinc inhibition of acid-sensing ion channels." J Neurosci. 24(40):8678-8689. PMID:15470133
  29. [ + ] Price MP, et al. (2004) "Stomatin modulates gating of acid-sensing ion channels." J Biol Chem. 279(51):53886-53891. PMID:15471860
  30. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  31. [ + ] Alvarez de la Rosa D, et al. (2003) "Distribution, subcellular localization and ontogeny of ASIC1 in the mammalian central nervous system." J Physiol. 546(Pt 1):77-87. PMID:12509480
  32. [ + ] Wemmie JA, et al. (2003) "Acid-sensing ion channel 1 is localized in brain regions with high synaptic density and contributes to fear conditioning." J Neurosci. 23(13):5496-5502. PMID:12843249
  33. [ + ] Leonard AS, et al. (2003) "cAMP-dependent protein kinase phosphorylation of the acid-sensing ion channel-1 regulates its binding to the protein interacting with C-kinase-1." Proc Natl Acad Sci U S A. 100(4):2029-2034. PMID:12578970
  34. [ + ] Benson CJ, et al. (2002) "Heteromultimers of DEG/ENaC subunits form H+-gated channels in mouse sensory neurons." Proc Natl Acad Sci U S A. 99(4):2338-2343. PMID:11854527
  35. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  36. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  37. [ + ] Wemmie JA, et al. (2002) "The acid-activated ion channel ASIC contributes to synaptic plasticity, learning, and memory." Neuron. 34(3):463-477. PMID:11988176
  38. [ + ] Bassler EL, et al. (2001) "Molecular and functional characterization of acid-sensing ion channel (ASIC) 1b." J Biol Chem. 276(36):33782-33787. PMID:11448963
  39. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  40. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  41. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  42. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  43. [ + ] Garcia-Anoveros J, et al. (1997) "BNaC1 and BNaC2 constitute a new family of human neuronal sodium channels related to degenerins and epithelial sodium channels." Proc Natl Acad Sci U S A. 94(4):1459-1464. PMID:9037075
  44. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548