Accn2 | GeneID:11419 | Mus musculus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 11419 | Official Symbol | Accn2 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | AI843610; ASIC; ASIC1; ASIC1a; B530003N02Rik; BNaC2 | ||
| Full Name | amiloride-sensitive cation channel 2, neuronal | ||
| Description | amiloride-sensitive cation channel 2, neuronal | ||
| Chromosome | 15 F3 | ||
| Also Known As | acid sensing ion channel; degenerin 2 | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 37440
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:41 | ACCN2 | NP_001086.2 | Homo sapiens |
| GeneID:11419 | Accn2 | NP_033727.1 | Mus musculus |
| GeneID:79123 | Accn2 | NP_077068.1 | Rattus norvegicus |
| GeneID:171992 | C24G7.4 | NP_491293.1 | Caenorhabditis elegans |
| GeneID:181468 | flr-1 | NP_510243.1 | Caenorhabditis elegans |
| GeneID:182851 | C24G7.1 | NP_491296.1 | Caenorhabditis elegans |
| GeneID:182852 | C24G7.2 | NP_491295.2 | Caenorhabditis elegans |
| GeneID:182963 | tag-324 | NP_510463.2 | Caenorhabditis elegans |
| GeneID:184882 | F23B2.3 | NP_501590.2 | Caenorhabditis elegans |
| GeneID:185036 | F28A12.1 | NP_505230.1 | Caenorhabditis elegans |
| GeneID:189051 | T28F2.7 | NP_491196.2 | Caenorhabditis elegans |
| GeneID:407670 | accn2c | NP_999954.1 | Danio rerio |
| GeneID:426883 | ACCN2 | NP_001035557.1 | Gallus gallus |
| GeneID:451888 | ACCN2 | XP_001155207.1 | Pan troglodytes |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | sigma | S7944 | Anti-Sodium Channel ASIC1 antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0043198 | Component | dendritic shaft |
| GO:0043197 | Component | dendritic spine |
| GO:0016021 | Component | integral to membrane |
| GO:0005887 | Component | integral to plasma membrane |
| GO:0016020 | Component | membrane |
| GO:0005886 | Component | plasma membrane |
| GO:0045202 | Component | synapse |
| GO:0019717 | Component | synaptosome |
| GO:0015280 | Function | amiloride-sensitive sodium channel activity |
| GO:0005509 | Function | calcium ion binding |
| GO:0005261 | Function | cation channel activity |
| GO:0005216 | Function | ion channel activity |
| GO:0015077 | Function | monovalent inorganic cation transmembrane transporter activity |
| GO:0005272 | Function | sodium channel activity |
| GO:0031402 | Function | sodium ion binding |
| GO:0008306 | Process | associative learning |
| GO:0006816 | Process | calcium ion transport |
| GO:0006812 | Process | cation transport |
| GO:0006811 | Process | ion transport |
| GO:0007613 | Process | memory |
| GO:0015672 | Process | monovalent inorganic cation transport |
| GO:0001101 | Process | response to acid |
| GO:0006814 | Process | sodium ion transport |
| GO:0006810 | Process | transport |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSMUST00000023758 | MI0005560 | hsa-miR-885-3p | AGGCAGCGGGGUGUAGUGGAUA |
| ENSMUST00000023758 | MI0005763 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENSMUST00000023758 | MI0005764 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENSMUST00000023758 | MI0005765 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENSMUST00000023758 | MI0005766 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENSMUST00000023758 | MI0000151 | mmu-miR-125a-3p | ACAGGUGAGGUUCUUGGGAGCC |
| ENSMUST00000023758 | MI0002401 | mmu-miR-466a-5p | UAUGUGUGUGUACAUGUACAUA |
| ENSMUST00000023758 | MI0005502 | mmu-miR-466b-5p | GAUGUGUGUGUACAUGUACAUG |
| ENSMUST00000023758 | MI0005503 | mmu-miR-466b-5p | GAUGUGUGUGUACAUGUACAUG |
| ENSMUST00000023758 | MI0005504 | mmu-miR-466b-5p | GAUGUGUGUGUACAUGUACAUG |
| ENSMUST00000023758 | MI0005505 | mmu-miR-466c-5p | GAUGUGUGUGUGCAUGUACAUA |
| ENSMUST00000023758 | MI0005506 | mmu-miR-466e-5p | GAUGUGUGUGUACAUGUACAUA |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Schnizler MK, et al. (2009) "The cytoskeletal protein alpha-actinin regulates acid-sensing ion channel 1a through a C-terminal interaction." J Biol Chem. 284(5):2697-2705. PMID:19028690 - [
] Coryell MW, et al. (2009) "Acid-sensing ion channel-1a in the amygdala, a novel therapeutic target in depression-related behavior." J Neurosci. 29(17):5381-5388. PMID:19403806 - [
] Cho JH, et al. (2008) "Presynaptic release probability is increased in hippocampal neurons from ASIC1 knockout mice." J Neurophysiol. 99(2):426-441. PMID:18094106 - [
] Ugawa S, et al. (2008) "Hypotonic stimuli enhance proton-gated currents of acid-sensing ion channel-1b." Biochem Biophys Res Commun. 367(3):530-534. PMID:18158916 - [
] Baron A, et al. (2008) "Acid sensing ion channels in dorsal spinal cord neurons." J Neurosci. 28(6):1498-1508. PMID:18256271 - [
] Ziemann AE, et al. (2008) "Seizure termination by acidosis depends on ASIC1a." Nat Neurosci. 11(7):816-822. PMID:18536711 - [
] Coryell MW, et al. (2008) "Restoring Acid-sensing ion channel-1a in the amygdala of knock-out mice rescues fear memory but not unconditioned fear responses." J Neurosci. 28(51):13738-13741. PMID:19091964 - [
] Sherwood TW, et al. (2008) "Endogenous arginine-phenylalanine-amide-related peptides alter steady-state desensitization of ASIC1a." J Biol Chem. 283(4):1818-1830. PMID:17984098 - [
] Coryell MW, et al. (2007) "Targeting ASIC1a reduces innate fear and alters neuronal activity in the fear circuit." Biol Psychiatry. 62(10):1140-1148. PMID:17662962 - [
] Hughes PA, et al. (2007) "Localization and comparative analysis of acid-sensing ion channel (ASIC1, 2, and 3) mRNA expression in mouse colonic sensory neurons within thoracolumbar dorsal root ganglia." J Comp Neurol. 500(5):863-875. PMID:17177258 - [
] Friese MA, et al. (2007) "Acid-sensing ion channel-1 contributes to axonal degeneration in autoimmune inflammation of the central nervous system." Nat Med. 13(12):1483-1489. PMID:17994101 - [
] Mazzuca M, et al. (2007) "A tarantula peptide against pain via ASIC1a channels and opioid mechanisms." Nat Neurosci. 10(8):943-945. PMID:17632507 - [
] Chai S, et al. (2007) "A kinase-anchoring protein 150 and calcineurin are involved in regulation of acid-sensing ion channels ASIC1a and ASIC2a." J Biol Chem. 282(31):22668-22677. PMID:17548344 - [
] Cho JH, et al. (2007) "Potentiation of acid-sensing ion channels by sulfhydryl compounds." Am J Physiol Cell Physiol. 292(6):C2161-C2174. PMID:17392378 - [
] Zha XM, et al. (2006) "Acid-sensing ion channel 1a is a postsynaptic proton receptor that affects the density of dendritic spines." Proc Natl Acad Sci U S A. 103(44):16556-16561. PMID:17060608 - [
] Ugawa S, et al. (2006) "Acid-sensing ion channel-1b in the stereocilia of mammalian cochlear hair cells." Neuroreport. 17(12):1235-1239. PMID:16951561 - [
] Chen CL, et al. (2006) "Runx1 determines nociceptive sensory neuron phenotype and is required for thermal and neuropathic pain." Neuron. 49(3):365-377. PMID:16446141 - [
] Vukicevic M, et al. (2006) "Trypsin cleaves acid-sensing ion channel 1a in a domain that is critical for channel gating." J Biol Chem. 281(2):714-722. PMID:16282326 - [
] Donier E, et al. (2005) "Annexin II light chain p11 promotes functional expression of acid-sensing ion channel ASIC1a." J Biol Chem. 280(46):38666-38672. PMID:16169854 - [
] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073 - [
] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072 - [
] Page AJ, et al. (2004) "The ion channel ASIC1 contributes to visceral but not cutaneous mechanoreceptor function." Gastroenterology. 127(6):1739-1747. PMID:15578512 - [
] Askwith CC, et al. (2004) "Acid-sensing ion channel 2 (ASIC2) modulates ASIC1 H+-activated currents in hippocampal neurons." J Biol Chem. 279(18):18296-18305. PMID:14960591 - [
] Wemmie JA, et al. (2004) "Overexpression of acid-sensing ion channel 1a in transgenic mice increases acquired fear-related behavior." Proc Natl Acad Sci U S A. 101(10):3621-3626. PMID:14988500 - [
] Drew LJ, et al. (2004) "Acid-sensing ion channels ASIC2 and ASIC3 do not contribute to mechanically activated currents in mammalian sensory neurones." J Physiol. 556(Pt 3):691-710. PMID:14990679 - [
] Wu LJ, et al. (2004) "Characterization of acid-sensing ion channels in dorsal horn neurons of rat spinal cord." J Biol Chem. 279(42):43716-43724. PMID:15302881 - [
] Xiong ZG, et al. (2004) "Neuroprotection in ischemia: blocking calcium-permeable acid-sensing ion channels." Cell. 118(6):687-698. PMID:15369669 - [
] Chu XP, et al. (2004) "Subunit-dependent high-affinity zinc inhibition of acid-sensing ion channels." J Neurosci. 24(40):8678-8689. PMID:15470133 - [
] Price MP, et al. (2004) "Stomatin modulates gating of acid-sensing ion channels." J Biol Chem. 279(51):53886-53891. PMID:15471860 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Alvarez de la Rosa D, et al. (2003) "Distribution, subcellular localization and ontogeny of ASIC1 in the mammalian central nervous system." J Physiol. 546(Pt 1):77-87. PMID:12509480 - [
] Wemmie JA, et al. (2003) "Acid-sensing ion channel 1 is localized in brain regions with high synaptic density and contributes to fear conditioning." J Neurosci. 23(13):5496-5502. PMID:12843249 - [
] Leonard AS, et al. (2003) "cAMP-dependent protein kinase phosphorylation of the acid-sensing ion channel-1 regulates its binding to the protein interacting with C-kinase-1." Proc Natl Acad Sci U S A. 100(4):2029-2034. PMID:12578970 - [
] Benson CJ, et al. (2002) "Heteromultimers of DEG/ENaC subunits form H+-gated channels in mouse sensory neurons." Proc Natl Acad Sci U S A. 99(4):2338-2343. PMID:11854527 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851 - [
] Wemmie JA, et al. (2002) "The acid-activated ion channel ASIC contributes to synaptic plasticity, learning, and memory." Neuron. 34(3):463-477. PMID:11988176 - [
] Bassler EL, et al. (2001) "Molecular and functional characterization of acid-sensing ion channel (ASIC) 1b." J Biol Chem. 276(36):33782-33787. PMID:11448963 - [
] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851 - [
] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159 - [
] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861 - [
] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636 - [
] Garcia-Anoveros J, et al. (1997) "BNaC1 and BNaC2 constitute a new family of human neuronal sodium channels related to degenerins and epithelial sodium channels." Proc Natl Acad Sci U S A. 94(4):1459-1464. PMID:9037075 - [
] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548
The acid-sensing ion channel 1a (ASIC1a) is widely expressed in central and peripheral neurons where it generates transient cation currents when extracellular pH falls. ASIC1a confers pH-dependent modulation on postsynaptic dendritic spines and has critical effects in neurological diseases associated with a reduced pH. However, knowledge of the proteins that interact with ASIC1a and influence its function is limited. Here, we show that alpha-actinin, which links membrane proteins to the actin cytoskeleton, associates with ASIC1a in brain and in cultured cells. The interaction depended on an alpha-actinin-binding site in the ASIC1a C terminus that was specific for ASIC1a versus other ASICs and for alpha-actinin-1 and -4. Co-expressing alpha-actinin-4 altered ASIC1a current density, pH sensitivity, desensitization rate, and recovery from desensitization. Moreover, reducing alpha-actinin expression altered acid-activated currents in hippocampal neurons. These findings suggest that alpha-actinins may link ASIC1a to a macromolecular complex in the postsynaptic membrane where it regulates ASIC1a activity.
No animal models replicate the complexity of human depression. However, a number of behavioral tests in rodents are sensitive to antidepressants and may thus tap important underlying biological factors. Such models may also offer the best opportunity to discover novel treatments. Here, we used several of these models to test the hypothesis that the acid-sensing ion channel-1a (ASIC1a) might be targeted to reduce depression. Genetically disrupting ASIC1a in mice produced antidepressant-like effects in the forced swim test, the tail suspension test, and following unpredictable mild stress. Pharmacologically inhibiting ASIC1a also had antidepressant-like effects in the forced swim test. The effects of ASIC1a disruption in the forced swim test were independent of and additive to those of several commonly used antidepressants. Furthermore, ASIC1a disruption interfered with an important biochemical marker of depression, the ability of stress to reduce BDNF in the hippocampus. Restoring ASIC1a to the amygdala of ASIC1a(-/-) mice with a viral vector reversed the forced swim test effects, suggesting that the amygdala is a key site of ASIC1a action in depression-related behavior. These data are consistent with clinical studies emphasizing the importance of the amygdala in mood regulation, and suggest that ASIC1a antagonists may effectively combat depression.
Acid-sensing ion channels (ASICs) are H(+)-gated channels that produce transient cation currents in response to extracellular acid. ASICs are expressed in neurons throughout the brain, and ASIC1 knockout mice show behavioral impairments in learning and memory. The role of ASICs in synaptic transmission, however, is not thoroughly understood. We analyzed the involvement of ASICs in synaptic transmission using microisland cultures of hippocampal neurons from wild-type and ASIC knockout mice. There was no significant difference in single action potential (AP)-evoked excitatory postsynaptic currents (EPSCs) between wild-type and ASIC knockout neurons. However, paired-pulse ratios (PPRs) were reduced and spontaneous miniature EPSCs (mEPSCs) occurred at a higher frequency in ASIC1 knockout neurons compared with wild-type neurons. The progressive block of NMDA receptors by an open channel blocker, MK-801, was also faster in ASIC1 knockout neurons. The amplitude and decay time constant of mEPSCs, as well as the size and refilling of the readily releasable pool, were similar in ASIC1 knockout and wild-type neurons. Finally, the release probability, which was estimated directly as the ratio of AP-evoked to hypertonic sucrose-induced charge transfer, was increased in ASIC1 knockout neurons. Transfection of ASIC1a into ASIC1 knockout neurons increased the PPRs, suggesting that alterations in release probability were not the result of developmental compensation within the ASIC1 knockout mice. Together, these findings demonstrate that neurons from ASIC1 knockout mice have an increased probability of neurotransmitter release and indicate that ASIC1a can affect presynaptic mechanisms of synaptic transmission.
Acid-sensing ion channels (ASICs) are strong candidates for mammalian mechanoreceptors. We investigated whether mouse acid-sensing ion channel-1b (ASIC1b) is sensitive to mechanical stimuli using oocyte electrophysiology, because ASIC1b is located in the mechanosensory stereocilia of cochlear hair cells. Hypotonic stimuli that induced membrane stretch of oocytes evoked no significant current in ASIC1b-expressing oocytes at pH 7.5. However, acid (pH 4.0 or 5.0)-evoked currents in the oocytes were substantially enhanced by the hypotonicity, showing mechanosensitivity of ASIC1b and possible mechanogating of the channel in the presence of other components. Interestingly, the ASIC1b channel was permeable to K(+) (a principal charge carrier for cochlear sensory transduction) and the affinity of the channel for amiloride (IC(50) (inhibition constant)=approximately 48.3 microM) was quite similar to that described for the mouse hair cell mechanotransducer current. Taken together, these data raise the possibility that ASIC1b participates in cochlear mechanoelectrical transduction.
Acid-sensing ion channels (ASICs) are broadly expressed in the CNS, including the spinal cord. However, very little is known about the properties of ASICs in spinal cord neurons compared with brain. We show here that ASIC1a and ASIC2a are the most abundant ASICs in mouse adult spinal cord and are coexpressed by most neurons throughout all the laminas. ASIC currents in cultured embryonic day 14 mouse dorsal spinal neurons mainly flow through homomeric ASIC1a (34% of neurons) and heteromeric ASIC1a plus 2a channels at a ratio of 2:1 (83% of neurons). ASIC2b only has a minor contribution to these currents. The two channel subtypes show different active pH ranges and different inactivation and reactivation kinetics supporting complementary functional properties. One striking property of native dorsal spinal neuron currents and recombinant currents is the pH dependence of the reactivation process. A light sustained acidosis induces a threefold slow-down of the homomeric ASIC1a (from pH 7.4 to pH 7.3) and heteromeric ASIC1a plus 2a (from pH 7.4 to pH 7.2) current reactivation (T(0.5) increasing from 5.77 to 16.84 s and from 0.98 to 3.2 s, respectively), whereas a larger acidosis to pH 6.6 induces a 32-fold slow-down of the ASIC1a plus 2a current reactivation (T(0.5) values increasing to 31.30 s). The pH dependence of ASIC channel reactivation is likely to modulate neuronal excitability associated with repetitive firing in response to extracellular pH oscillations, which can be induced, for example, by intense synaptic activity of central neurons.
Most seizures stop spontaneously; however, the molecular mechanisms that terminate seizures remain unknown. Observations that seizures reduced brain pH and that acidosis inhibited seizures indicate that acidosis halts epileptic activity. Because acid-sensing ion channel 1a (ASIC1a) is exquisitely sensitive to extracellular pH and regulates neuron excitability, we hypothesized that acidosis might activate ASIC1a, which would terminate seizures. Disrupting mouse ASIC1a increased the severity of chemoconvulsant-induced seizures, whereas overexpressing ASIC1a had the opposite effect. ASIC1a did not affect seizure threshold or onset, but shortened seizure duration and prevented seizure progression. CO2 inhalation, long known to lower brain pH and inhibit seizures, required ASIC1a to interrupt tonic-clonic seizures. Acidosis activated inhibitory interneurons through ASIC1a, suggesting that ASIC1a might limit seizures by increasing inhibitory tone. Our results identify ASIC1a as an important element in seizure termination when brain pH falls and suggest both a molecular mechanism for how the brain stops seizures and new therapeutic strategies.
Acid-sensing ion channel-1a (ASIC1a) contributes to multiple fear behaviors, however the site of ASIC1a action in behavior is not known. To explore a specific location of ASIC1a action, we expressed ASIC1a in the basolateral amygdala of ASIC1a-/- mice using viral vector-mediated gene transfer. This rescued context-dependent fear memory, but not the freezing deficit during training or the unconditioned fear response to predator odor. These data pinpoint the basolateral amygdala as the site where ASIC1a contributes to fear memory. They also discriminate fear memory from fear expressed during training and from unconditioned fear. Furthermore, this work illustrates a strategy for identifying discrete brain regions where specific genes contribute to complex behaviors.
The acid-sensing ion channels (ASICs) are proton-gated, voltage-insensitive cation channels expressed throughout the nervous system. ASIC1a plays a role in learning, pain, and fear-related behaviors. In addition, activation of ASIC1a during prolonged acidosis following cerebral ischemia induces neuronal death. ASICs undergo steady-state desensitization, a characteristic that limits ASIC1a activity and may play a prominent role in the prevention of ASIC1a-evoked neuronal death. In this study, we found exogenous and endogenous arginine-phenylalanine-amide (RF-amide)-related peptides decreased the pH sensitivity of ASIC1a steady-state desensitization. During conditions that normally induced steady-state desensitization, these peptides profoundly enhanced ASIC1a activity. We also determined that human ASIC1a required more acidic pH to undergo steady-state desensitization compared with mouse ASIC1a. Surprisingly, steady-state desensitization of human ASIC1a was also affected by a greater number of peptides compared with mouse ASIC1a. Mutation of five amino acids in a region of the extracellular domain changed the characteristics of human ASIC1a to those of mouse ASIC1a, suggesting that this region plays a pivotal role in neuropeptide and pH sensitivity of steady-state desensitization. Overall, these experiments lend vital insight into steady-state desensitization of ASIC1a and expand our understanding of the structural determinants of RF-amide-related peptide modulation. Furthermore, our finding that endogenous peptides shift steady-state desensitization suggests that RF-amides could impact the role of ASIC1a in both pain and neuronal damage following stroke and ischemia.
BACKGROUND: The molecular mechanisms underlying innate fear are poorly understood. Previous studies indicated that the acid sensing ion channel ASIC1a influences fear behavior in conditioning paradigms. However, these differences may have resulted from an ASIC1a effect on learning, memory, or the expression of fear. METHODS: To test the hypothesis that ASIC1a influences the expression of fear or anxiety independent of classical conditioning, we examined the effects of disrupting the mouse ASIC1a gene on unconditioned fear in the open field test, unconditioned acoustic startle, and fear evoked by the predator odor trimethylthiazoline (TMT). In addition, we tested the effects of acutely inhibiting ASIC1a with PcTx, an ASIC1a antagonist in tarantula venom. Our immunohistochemistry suggested ASIC1a is expressed in the bed nucleus of the stria terminalis, medial amygdala, and periaqueductal gray, which are thought to play important roles in the generation and expression of innate fear. Therefore, we also tested whether ASIC1a disruption altered c-fos expression in these structures following TMT exposure. RESULTS: We found that the loss of ASIC1a reduced fear in the open field test, reduced acoustic startle, and inhibited the fear response to TMT. Similarly, intracerebroventricular administration of PcTx reduced TMT-evoked freezing in ASIC1a(+/+) mice but not ASIC1a(-/-) mice. In addition, loss of ASIC1a altered TMT-evoked c-fos expression in the medial amydala and dorsal periaqueductal gray. CONCLUSIONS: These findings suggest that ASIC1a modulates activity in the circuits underlying innate fear. Furthermore, the data indicate that targeting the ASIC1a gene or acutely inhibiting ASIC1a suppresses fear and anxiety independent of conditioning.
Reducing colonic mechanosensitivity is an important potential strategy for reducing visceral pain. Mice lacking acid-sensing ion channels (ASIC) 1, 2, and 3 show altered colonic mechanosensory function, implicating ASICs in the mechanotransduction process. Deletion of ASICs affects mechanotransduction in visceral and cutaneous afferents differently, suggesting differential expression. We determined relative expression of ASIC1, 2, and 3 in mouse thoracolumbar dorsal root ganglia (DRG) by quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) analysis (QPCR) and specifically in retrogradely traced colonic neurons isolated via laser capture microdissection. Localization of ASIC expression in DRG was determined with fluorescence in situ hybridization (FISH) and retrograde tracing. QPCR of whole thoracolumbar DRG revealed and abundance of ASIC2 > ASIC1 > ASIC3. Similarly, FISH of all neurons in thoracolumbar DRG demonstrated that ASIC2 was expressed in the most (40 +/- 1%) neurons, followed by ASIC3 (24 +/- 1%), then ASIC1 (18 +/- 1%). Retrograde tracing from the distal colon labeled 4 +/- 1% of neurons in T10-L1 DRG. In contrast to whole DRG, FISH of colonic neurons showed ASIC3 expression in 73 +/- 2%, ASIC2 in 47 +/- 0.5%, and ASIC1 in 30 +/- 2%. QPCR of laser captured colonic neurons revealed that ASIC3 was the most abundant ASIC transcript, followed by ASIC1, then ASIC2. We conclude that ASIC1, 2, and 3 are expressed preferentially in colonic neurons within thoracolumbar DRG. In particular ASIC3, the least abundant in the general population, is the most abundant ASIC transcript in colonic neurons. The prevalence of ASIC3 in neurons innervating the colon supports electrophysiological data showing that it makes a major contribution to colonic mechanotransduction and therefore may be a target for the treatment of visceral pain.
Multiple sclerosis is a neuroinflammatory disease associated with axonal degeneration. The neuronally expressed, proton-gated acid-sensing ion channel-1 (ASIC1) is permeable to Na+ and Ca2+, and excessive accumulation of these ions is associated with axonal degeneration. We tested the hypothesis that ASIC1 contributes to axonal degeneration in inflammatory lesions of the central nervous system (CNS). After induction of experimental autoimmune encephalomyelitis (EAE), Asic1-/- mice showed both a markedly reduced clinical deficit and reduced axonal degeneration compared to wild-type mice. Consistently with acidosis-mediated injury, pH measurements in the spinal cord of EAE mice showed tissue acidosis sufficient to open ASIC1. The acidosis-related protective effect of Asic1 disruption was also observed in nerve explants in vitro. Amiloride, a licensed and clinically safe blocker of ASICs, was equally neuroprotective in nerve explants and in EAE. Although ASICs are also expressed by immune cells, this expression is unlikely to explain the neuroprotective effect of Asic1 inactivation, as CNS inflammation was similar in wild-type and Asic1-/- mice. In addition, adoptive transfer of T cells from wild-type mice did not affect the protection mediated by Asic1 disruption. These results suggest that ASIC1 blockers could provide neuroprotection in multiple sclerosis.
Psalmotoxin 1, a peptide extracted from the South American tarantula Psalmopoeus cambridgei, has very potent analgesic properties against thermal, mechanical, chemical, inflammatory and neuropathic pain in rodents. It exerts its action by blocking acid-sensing ion channel 1a, and this blockade results in an activation of the endogenous enkephalin pathway. The analgesic properties of the peptide are suppressed by antagonists of the mu and delta-opioid receptors and are lost in Penk1-/- mice.
Acid-sensing ion channel (ASIC) 1a and ASIC2a are acid-sensing ion channels in central and peripheral neurons. ASIC1a has been implicated in long-term potentiation of synaptic transmission and ischemic brain injury, whereas ASIC2a is involved in mechanosensation. Although the biological role and distribution of ASIC1a and ASIC2a subunits in brain have been well characterized, little is known about the intracellular regulation of these ion channels that modulates their function. Using pulldown assays and mass spectrometry, we have identified A kinase-anchoring protein (AKAP)150 and the protein phosphatase calcineurin as binding proteins to ASIC2a. Extended pulldown and co-immunoprecipitation assays showed that these regulatory proteins also interact with ASIC1a. Transfection of rat cortical neurons with constructs encoding green fluorescent protein- or hemagglutinin-tagged channels showed expression of ASIC1a and ASIC2a in punctate and clustering patterns in dendrites that co-localized with AKAP150. Inhibition of protein kinase A binding to AKAPs by Ht-31 peptide reduces ASIC currents in cortical neurons and Chinese hamster ovary cells, suggesting a role of AKAP150 in association with protein kinase A in ASIC function. We also demonstrated a regulatory function of calcineurin in ASIC1a and ASIC2a activity. Cyclosporin A, an inhibitor of calcineurin, increased ASIC currents in Chinese hamster ovary cells and in cortical neurons, suggesting that activity of ASICs is inhibited by calcineurin-dependent dephosphorylation. These data imply that ASIC down-regulation by calcineurin could play an important role under pathological conditions accompanying intracellular Ca(2+) overload and tissue acidosis to circumvent harmful activities mediated by these channels.
The acid-sensing ion channels (ASICs) are voltage-independent ion channels activated by acidic extracellular pH. ASICs play a role in sensory transduction, behavior, and acidotoxic neuronal death, which occurs during stroke and ischemia. During these conditions, the extracellular concentration of sulfhydryl reducing agents increases. We used perforated patch-clamp technique to analyze the impact of sulfhydryls on H(+)-gated currents from Chinese hamster ovary (CHO) cells expressing human ASIC1a (hASIC1a). We found that hASIC1a currents activated by pH 6.5 were increased almost twofold by the sulfhydryl-containing reducing agents dithiothreitol (DTT) and glutathione. DTT shifted the pH-dose response of hASIC1a toward a more neutral pH (pH(0.5) from 6.54 to 6.69) and slowed channel desensitization. The effect of reducing agents on native mouse hippocampal neurons and transfected mouse ASIC1a was similar. We found that the effect of DTT on hASIC1a was mimicked by the metal chelator TPEN, and mutant hASIC1a channels with reduced TPEN potentiation showed reduced DTT potentiation. Furthermore, the addition of DTT in the presence of TPEN did not result in further increases in current amplitude. These results suggest that the effect of DTT on hASIC1a is due to relief of tonic inhibition by transition metal ions. We found that all ASICs examined remained potentiated following the removal of DTT. This effect was reversed by the oxidizing agent DTNB in hASIC1a, supporting the hypothesis that DTT also impacts ASICs via a redox-sensitive site. Thus sulfhydryl compounds potentiate H(+)-gated currents via two mechanisms, metal chelation and redox modulation of target amino acids.
Extracellular proton concentrations in the brain may be an important signal for neuron function. Proton concentrations change both acutely when synaptic vesicles release their acidic contents into the synaptic cleft and chronically during ischemia and seizures. However, the brain receptors that detect protons and their physiologic importance remain uncertain. Using organotypic hippocampal slices and biolistic transfection, we found the acid-sensing ion channel 1a (ASIC1a), localized in dendritic spines where it functioned as a proton receptor. ASIC1a also affected the density of spines, the postsynaptic site of most excitatory synapses. Decreasing ASIC1a reduced the number of spines, whereas overexpressing ASIC1a had the opposite effect. Ca(2+)-mediated Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) signaling was probably responsible, because acid evoked an ASIC1a-dependent elevation of spine intracellular Ca(2+) concentration, and reducing or increasing ASIC1a levels caused parallel changes in CaMKII phosphorylation in vivo. Moreover, inhibiting CaMKII prevented ASIC1a from increasing spine density. These data indicate that ASIC1a functions as a postsynaptic proton receptor that influences intracellular Ca(2+) concentration and CaMKII phosphorylation and thereby the density of dendritic spines. The results provide insight into how protons influence brain function and how they may contribute to pathophysiology.
We investigated whether amiloride-blockable proton-gated cation channels ASIC1a (acid-sensing ion channel-1a) and ASIC1b are expressed in the stereocilia of mouse cochlear hair cells. In-situ hybridization studies showed that ASIC1b transcripts, but not ASIC1a transcripts, were expressed in the inner and outer hair cells. Fluorescent immunohistochemical and immunogold electron microscopic analyses revealed that the ASIC1b channels were located at the insertions of the stereocilia into the hair cells. Our findings provide a novel molecular key to the understanding of cochlear physiology and pathophysiology.
In mammals, the perception of pain is initiated by the transduction of noxious stimuli through specialized ion channels and receptors expressed by nociceptive sensory neurons. The molecular mechanisms responsible for the specification of distinct sensory modality are, however, largely unknown. We show here that Runx1, a Runt domain transcription factor, is expressed in most nociceptors during embryonic development but in adult mice, becomes restricted to nociceptors marked by expression of the neurotrophin receptor Ret. In these neurons, Runx1 regulates the expression of many ion channels and receptors, including TRP class thermal receptors, Na+-gated, ATP-gated, and H+-gated channels, the opioid receptor MOR, and Mrgpr class G protein coupled receptors. Runx1 also controls the lamina-specific innervation pattern of nociceptive afferents in the spinal cord. Moreover, mice lacking Runx1 exhibit specific defects in thermal and neuropathic pain. Thus, Runx1 coordinates the phenotype of a large cohort of nociceptors, a finding with implications for pain therapy.
Acid-sensing ion channels (ASICs) are neuronal Na(+) channels that are members of the epithelial Na(+) channel/degenerin family and are transiently activated by extracellular acidification. ASICs in the central nervous system have a modulatory role in synaptic transmission and are involved in cell injury induced by acidosis. We have recently demonstrated that ASIC function is regulated by serine proteases. We provide here evidence that this regulation of ASIC function is tightly linked to channel cleavage. Trypsin cleaves ASIC1a with a similar time course as it changes ASIC1a function, whereas ASIC1b, whose function is not modified by trypsin, is not cleaved. Trypsin cleaves ASIC1a at Arg-145, in the N-terminal part of the extracellular loop, between a highly conserved sequence and a sequence that is critical for ASIC1a inhibition by the venom of the tarantula Psalmopoeus cambridgei. This channel domain controls the inactivation kinetics and co-determines the pH dependence of ASIC gating. It undergoes a conformational change during inactivation, which renders the cleavage site inaccessible to trypsin in inactivated channels.
Acid-sensing ion channels (ASICs) have been implicated in a wide variety of physiological functions. We have used a rat dorsal root ganglion cDNA library in a yeast two-hybrid assay to identify sensory neuron proteins that interact with ASICs. We found that annexin II light chain p11 physically interacts with the N terminus of ASIC1a, but not other ASIC isoforms. Immunoprecipitation studies confirmed an interaction between p11 and ASIC1 in rat dorsal root ganglion neurons in vivo. Coexpression of p11 and ASIC1a in CHO-K1 cells led to a 2-fold increase in expression of the ion channel at the cell membrane as determined by membrane-associated immunoreactivity and cell-surface biotinylation. Consistent with these findings, peak ASIC1a currents in transfected CHO-K1 cells were up-regulated 2-fold in the presence of p11, whereas ASIC3-mediated currents were unaffected by p11 expression. Neither the pH dependence of activation nor the rates of desensitization were altered by p11, suggesting that its primary role in regulating ASIC1a activity is to enhance cell-surface expression of ASIC1a. These data demonstrate that p11, already known to traffic members of the voltage-gated sodium and potassium channel families as well as transient receptor potential and chloride channels, also plays a selective role in enhancing ASIC1a functional expression.
Antisense transcription (transcription from the opposite strand to a protein-coding or sense strand) has been ascribed roles in gene regulation involving degradation of the corresponding sense transcripts (RNA interference), as well as gene silencing at the chromatin level. Global transcriptome analysis provides evidence that a large proportion of the genome can produce transcripts from both strands, and that antisense transcripts commonly link neighboring "genes" in complex loci into chains of linked transcriptional units. Expression profiling reveals frequent concordant regulation of sense/antisense pairs. We present experimental evidence that perturbation of an antisense RNA can alter the expression of sense messenger RNAs, suggesting that antisense transcription contributes to control of transcriptional outputs in mammals.
This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins. Genomic mapping of the transcriptome reveals transcriptional forests, with overlapping transcription on both strands, separated by deserts in which few transcripts are observed. The data provide a comprehensive platform for the comparative analysis of mammalian transcriptional regulation in differentiation and development.
BACKGROUND & AIMS: Visceral mechanoreceptors are critical for perceived sensations and autonomic reflex control of gastrointestinal function. However, the molecular mechanisms underlying visceral mechanosensation remain poorly defined. Degenerin/epithelial Na+ channel (DEG/ENaC) family ion channels are candidate mechanosensory molecules, and we hypothesized that they influence visceral mechanosensation. We examined the influence of the DEG/ENaC channel ASIC1 on gastrointestinal mechanosensory function, on gastric emptying, and on fecal output. We also compared its role in gastrointestinal and somatic sensory function. METHODS: To assess the role of ASIC1 we studied wild-type and ASIC1-/- mice. Reverse-transcription polymerase chain reaction (RT-PCR) and Western blot analysis determined expression of ASIC1 messenger RNA and protein in vagal and spinal sensory ganglia. Colonic, gastroesophageal, and cutaneous afferent fibers were characterized by functional subtype and their mechanical stimulus-response relationships were determined. Gastric emptying was determined by using a 13CO2 breath test. Behavioral tests assessed somatic mechanical and thermal sensitivity. RESULTS: ASIC1 was expressed in sensory ganglia and was lost after disruption of the ASIC1 gene. Loss of ASIC1 increased mechanosensitivity in all colonic and gastroesophageal mechanoreceptor subtypes. In addition, ASIC1-/- mice showed almost double the gastric emptying time of wild-type mice. In contrast, loss of ASIC1 did not affect function in any of the 5 types of cutaneous mechanoreceptors, nor did it affect paw withdrawal responses or fecal output. CONCLUSIONS: ASIC1 influences visceral but not cutaneous mechanoreceptor function, suggesting that different mechanisms underlie mechanosensory function in gut and skin. The role of ASIC1 is highlighted by prolonging gastric emptying of a meal in ASIC1-/- animals.
Hippocampal neurons express subunits of the acid-sensing ion channel (ASIC1 and ASIC2) and exhibit large cation currents that are transiently activated by acidic extracellular solutions. Earlier work indicated that ASIC1 contributed to the current in these neurons and suggested its importance for normal behavior. However, the specific contribution of ASIC1 and ASIC2 subunits to acid-evoked currents in hippocampal neurons remained uncertain. To decipher the individual role of the ASIC subunits, we studied H(+)-gated currents in neurons from both ASIC1 and ASIC2 null mice. We found that much of the current was produced by ASIC1a/2a heteromultimeric channels, and individual subunits made distinct contributions. The ASIC1a subunit was key in establishing current amplitude. The ASIC2a subunit had little effect on amplitude but influenced desensitization, recovery from desensitization, pH sensitivity, and the response to modulatory agents. We also found heterogeneity in the contribution of ASIC2 throughout the neuronal population, with individual neurons expressing both ASIC1a homomultimeric and ASIC1a/2a heteromultimeric channels. Studies of neurons heterozygous for disrupted ASIC alleles indicated that the properties of H(+)-gated currents are dependent on the proportion of the individual subunits. These findings indicate that the absolute and relative amounts of ASIC subunits determine the amplitude and properties of hippocampal H(+)-gated currents and therefore may contribute to normal physiology and pathophysiology.
The acid-sensing ion channel 1a (ASIC1a) is abundantly expressed in the amygdala complex and other brain regions associated with fear. Studies of mice with a disrupted ASIC1 gene suggested that ASIC1a may contribute to learned fear. To test this hypothesis, we generated mice overexpressing human ASIC1a by using the pan-neuronal synapsin 1 promoter. Transgenic ASIC1a interacted with endogenous mouse ASIC1a and was distributed to the synaptosomal fraction of brain. Transgenic expression of ASIC1a also doubled neuronal acid-evoked cation currents. The amygdala showed prominent expression, and overexpressing ASIC1a enhanced fear conditioning, an animal model of acquired anxiety. These data raise the possibility that ASIC1a and H(+)-gated currents may contribute to the development of abnormal fear and to anxiety disorders in humans.
The molecular basis of mechanosensory transduction by primary sensory neurones remains poorly understood. Amongst candidate transducer molecules are members of the acid-sensing ion channel (ASIC) family; nerve fibre recordings have shown ASIC2 and ASIC3 null mutants have aberrant responses to suprathreshold mechanical stimuli. Using the neuronal cell body as a model of the sensory terminal we investigated if ASIC2 or 3 contributed to mechanically activated currents in dorsal root ganglion (DRG) neurones. We cultured neurones from ASIC2 and ASIC3 null mutants and compared response properties with those of wild-type controls. Neuronal subpopulations [categorized by cell size, action potential duration and isolectin B4 (IB4) binding] generated distinct responses to mechanical stimulation consistent with their predicted in vivo phenotypes. In particular, there was a striking relationship between action potential duration and mechanosensitivity as has been observed in vivo. Putative low threshold mechanoreceptors exhibited rapidly adapting mechanically activated currents. Conversely, when nociceptors responded they displayed slowly or intermediately adapting currents that were smaller in amplitude than responses of low threshold mechanoreceptor neurones. No differences in current amplitude or kinetics were found between ASIC2 and/or ASIC3 null mutants and controls. Ruthenium red (5 microm) blocked mechanically activated currents in a voltage-dependent manner, with equal efficacy in wild-type and knockout animals. Analysis of proton-gated currents revealed that in wild-type and ASIC2/3 double knockout mice the majority of putative low threshold mechanoreceptors did not exhibit ASIC-like currents but exhibited a persistent current in response to low pH. Our findings are consistent with another ion channel type being important in DRG mechanotransduction.
Acid-sensing ion channels (ASICs) are ligand-gated cation channels activated by extracellular protons. In periphery, they contribute to sensory transmission, including that of nociception and pain. Here we characterized ASIC-like currents in dorsal horn neurons of the rat spinal cord and their functional modulation in pathological conditions. Reverse transcriptase-nested PCR and Western blotting showed that three ASIC isoforms, ASIC1a, ASIC2a, and ASIC2b, are expressed at a high level in dorsal horn neurons. Electrophysiological and pharmacological properties of the proton-gated currents suggest that homomeric ASIC1a and/or heteromeric ASIC1a + 2b channels are responsible for the proton-induced currents in the majority of dorsal horn neurons. Acidification-induced action potentials in these neurons were compatible in a pH-dependent manner with the pH dependence of ASIC-like current. Furthermore, peripheral complete Freund's adjuvant-induced inflammation resulted in increased expression of both ASIC1a and ASIC2a in dorsal horn. These results support the idea that the ASICs of dorsal horn neurons participate in central sensory transmission/modulation under physiological conditions and may play important roles in inflammation-related persistent pain.
Ca2+ toxicity remains the central focus of ischemic brain injury. The mechanism by which toxic Ca2+ loading of cells occurs in the ischemic brain has become less clear as multiple human trials of glutamate antagonists have failed to show effective neuroprotection in stroke. Acidosis is a common feature of ischemia and is assumed to play a critical role in brain injury; however, the mechanism(s) remain ill defined. Here, we show that acidosis activates Ca2+ -permeable acid-sensing ion channels (ASICs), inducing glutamate receptor-independent, Ca2+ -dependent, neuronal injury inhibited by ASIC blockers. Cells lacking endogenous ASICs are resistant to acid injury, while transfection of Ca2+ -permeable ASIC1a establishes sensitivity. In focal ischemia, intracerebroventricular injection of ASIC1a blockers or knockout of the ASIC1a gene protects the brain from ischemic injury and does so more potently than glutamate antagonism. Thus, acidosis injures the brain via membrane receptor-based mechanisms with resultant toxicity of [Ca2+]i, disclosing new potential therapeutic targets for stroke.
Acid-sensing ion channels (ASICs), a novel class of ligand-gated cation channels activated by protons, are highly expressed in peripheral sensory and central neurons. Activation of ASICs may play an important role in physiological processes such as nociception, mechanosensation, and learning-memory, and in the pathology of neurological conditions such as brain ischemia. Modulation of the activities of ASICs is expected to have a significant influence on the roles that these channels can play in both physiological and/or pathological processes. Here we show that the divalent cation Zn2+, an endogenous trace element, dose-dependently inhibits ASIC currents in cultured mouse cortical neurons at nanomolar concentrations. With ASICs expressed in Chinese hamster ovary cells, Zn2+ inhibits currents mediated by homomeric ASIC1a and heteromeric ASIC1a-ASIC2a channels, without affecting currents mediated by homomeric ASIC1beta, ASIC2a, or ASIC3. Consistent with ASIC1a-specific modulation, high-affinity Zn2+ inhibition is absent in neurons from ASIC1a knock-out mice. Current-clamp recordings and Ca2+-imaging experiments demonstrated that Zn2+ inhibits acid-induced membrane depolarization and the increase of intracellular Ca2+. Mutation of lysine-133 in the extracellular domain of the ASIC1a subunit abolishes the high-affinity Zn2+ inhibition. Our studies suggest that Zn2+ may play an important role in a negative feedback system for preventing overexcitation of neurons during normal synaptic transmission and ASIC1a-mediated excitotoxicity in pathological conditions.
Acid-sensing ion channels (ASICs) are H(+)-gated members of the degenerin/epithelial Na(+) channel (DEG/ENaC) family in vertebrate neurons. Several ASICs are expressed in sensory neurons, where they play a role in responses to nociceptive, taste, and mechanical stimuli; others are expressed in central neurons, where they participate in synaptic plasticity and some forms of learning. Stomatin is an integral membrane protein found in lipid/protein-rich microdomains, and it is believed to regulate the function of ion channels and transporters. In Caenorhabditis elegans, stomatin homologs interact with DEG/ENaC channels, which together are necessary for normal mechanosensation in the worm. Therefore, we asked whether stomatin interacts with and modulates the function of ASICs. We found that stomatin co-immunoprecipitated and co-localized with ASIC proteins in heterologous cells. Moreover, stomatin altered the function of ASIC channels. Stomatin potently reduced acid-evoked currents generated by ASIC3 without changing steady state protein levels or the amount of ASIC3 expressed at the cell surface. In contrast, stomatin accelerated the desensitization rate of ASIC2 and heteromeric ASICs, whereas current amplitude was unaffected. These data suggest that stomatin binds to and alters the gating of ASICs. Our findings indicate that modulation of DEG/ENaC channels by stomatin-like proteins is evolutionarily conserved and may have important implications for mammalian nociception and mechanosensation.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
The acid-sensitive ion channel ASIC1 is a proton-gated ion channel from the mammalian nervous system. Its expression in sensory neurons and activation by low extracellular pH suggest that ASIC is involved in transmitting nociceptive impulses produced by the acidification caused by injury or inflammation. However, ASIC1 expression is not restricted to sensory neurons. To understand the functional role of ASIC1 in the CNS we investigated its expression and subcellular distribution therein. In particular, we examined the presence of ASIC1 in domains where the local pH may drop sufficiently to activate ASIC1 under physiological conditions. Immunostaining with specific antibodies revealed broad expression of ASIC1 in many areas of the adult rat brain including the cerebral cortex, hippocampus and cerebellum. Within cells, ASIC1 was found predominantly throughout the soma and along the branches of axons and dendrites. ASIC1 was not enriched in the microdomains where pH may reach low values, such as in synaptic vesicles or synaptic membranes. Pre- or postsynaptic ASIC1 was not gated by synaptic activity in cultured hippocampal neurons. Blockage or desensitization of ASIC1 with amiloride or pH 6.7, respectively, did not modify postsynaptic currents. Finally, the ontogeny of ASIC1 in mouse brain revealed constant levels of expression of ASIC1 protein from embryonic day 12 to the postnatal period, indicating an early and almost constant level of expression of ASIC1 during brain development.
The acid-sensing ion channel, ASIC1, contributes to synaptic plasticity in the hippocampus and to hippocampus-dependent spatial memory. To explore the role of ASIC1 in brain, we examined the distribution of ASIC1 protein. Surprisingly, although ASIC1 was present in the hippocampal circuit, it was much more abundant in several areas outside the hippocampus. ASIC1 was enriched in areas with strong excitatory synaptic input such as the glomerulus of the olfactory bulb, whisker barrel cortex, cingulate cortex, striatum, nucleus accumbens, amygdala, and cerebellar cortex. Because ASIC1 levels were particularly high in the amygdala, we focused further on this area. We found that extracellular acidosis elicited a greater current density in amygdala neurons than hippocampal neurons and that disrupting the ASIC1 gene eliminated H+-evoked currents in the amygdala. We also tested the effect of ASIC1 on amygdala-dependent behavior; ASIC1-null mice displayed deficits in cue and context fear conditioning, yet baseline fear on the elevated plus maze was intact. These studies suggest that ASIC1 is distributed to regions supporting high levels of synaptic plasticity and contributes to the neural mechanisms of fear conditioning.
The acid-sensing ion channel-1 (ASIC1) contributes to synaptic plasticity and may influence the response to cerebral ischemia and acidosis. We found that cAMP-dependent protein kinase phosphorylated heterologously expressed ASIC1 and endogenous ASIC1 in brain slices. ASIC1 also showed significant phosphorylation under basal conditions. Previous studies showed that the extreme C-terminal residues of ASIC1 bind the PDZ domain of the protein interacting with C-kinase-1 (PICK1). We found that protein kinase A phosphorylation of Ser-479 in the ASIC1 C terminus interfered with PICK1 binding. In contrast, minimizing phosphorylation or mutating Ser-479 to Ala enhanced PICK1 binding. Phosphorylation-dependent disruption of PICK1 binding reduced the cellular colocalization of ASIC1 and PICK1. Thus, the ASIC1 C terminus contains two sites that influence its binding to PICK1. Regulation of this interaction by phosphorylation provides a mechanism to control the cellular localization of ASIC1.
Acidic extracellular solution activates transient H(+)-gated currents in dorsal root ganglion (DRG) neurons. The biophysical properties of three degenerin/epithelial sodium (DEG/ENaC) channel subunits (BNC1, ASIC, and DRASIC), and their expression in DRG, suggest that they might underlie these H(+)-gated currents and function as sensory transducers. However, it is uncertain which of these DEG/ENaC subunits generate the currents, and whether they function as homomultimers or heteromultimers. We found that the biophysical properties of transient H(+)-gated currents from medium to large mouse DRG neurons differed from BNC1, ASIC, or DRASIC expressed individually, but were reproduced by coexpression of the subunits together. To test the contribution of each subunit, we studied DRG from three strains of mice, each bearing a targeted disruption of BNC1, ASIC, or DRASIC. Deletion of any one subunit did not abolish H(+)-gated currents, but altered currents in a manner consistent with heteromultimerization of the two remaining subunits. These data indicate that combinations of two or more DEG/ENaC subunits coassemble as heteromultimers to generate transient H(+)-gated currents in mouse DRG neurons.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
Only a small proportion of the mouse genome is transcribed into mature messenger RNA transcripts. There is an international collaborative effort to identify all full-length mRNA transcripts from the mouse, and to ensure that each is represented in a physical collection of clones. Here we report the manual annotation of 60,770 full-length mouse complementary DNA sequences. These are clustered into 33,409 'transcriptional units', contributing 90.1% of a newly established mouse transcriptome database. Of these transcriptional units, 4,258 are new protein-coding and 11,665 are new non-coding messages, indicating that non-coding RNA is a major component of the transcriptome. 41% of all transcriptional units showed evidence of alternative splicing. In protein-coding transcripts, 79% of splice variations altered the protein product. Whole-transcriptome analyses resulted in the identification of 2,431 sense-antisense pairs. The present work, completely supported by physical clones, provides the most comprehensive survey of a mammalian transcriptome so far, and is a valuable resource for functional genomics.
Many central neurons possess large acid-activated currents, yet their molecular identity is unknown. We found that eliminating the acid sensing ion channel (ASIC) abolished H(+)-gated currents in hippocampal neurons. Neuronal H(+)-gated currents and transient acidification are proposed to play a role in synaptic transmission. Investigating this possibility, we found ASIC in hippocampus, in synaptosomes, and in dendrites localized at synapses. Moreover, loss of ASIC impaired hippocampal long-term potentiation. ASIC null mice had reduced excitatory postsynaptic potentials and NMDA receptor activation during high-frequency stimulation. Consistent with these findings, null mice displayed defective spatial learning and eyeblink conditioning. These results identify ASIC as a key component of acid-activated currents and implicate these currents in processes underlying synaptic plasticity, learning, and memory.
Acid-sensing ion channels (ASICs) are activated by extracellular protons and are involved in neurotransmission in the central nervous system, in pain perception, as well as in mechanotransduction. Six different ASIC subunits have been cloned to date, which are encoded by four genes (ASIC1-ASIC4). Proton-gated currents have been described in isolated neurons from sensory ganglia as well as from central nervous system. However, it is largely unclear which of the cloned ASIC subunits underlie these native proton-gated currents. Recently, a splice variant, ASIC-beta, has been described for ASIC1a. In this variant about one-third of the protein is exchanged at the N terminus. Here we show that ASIC-beta has a longer N terminus than previously reported, extending the sequence divergence between ASIC1a and this new variant (ASIC1b). We investigated in detail kinetic and selectivity properties of ASIC1b in comparison to ASIC1a. Kinetics is similar for ASIC1b and ASIC1a. Ca(2+) permeability of ASIC1a is low, whereas ASIC1b is impermeable to Ca(2+). Currents through ASIC1a resemble currents, which have been described in sensory and central neurons, whereas the significance of ASIC1b remains to be established. Moreover, we show that a pre-transmembrane 1 domain controls the permeability to divalent cations in ASIC1, contributing to our understanding of the pore structure of these channels.
The RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full-length complementary DNAs and physical mapping of the corresponding genes to the mouse genome. We organized an international functional annotation meeting (FANTOM) to annotate the first 21,076 cDNAs to be analysed in this project. Here we describe the first RIKEN clone collection, which is one of the largest described for any organism. Analysis of these cDNAs extends known gene families and identifies new ones.
In the effort to prepare the mouse full-length cDNA encyclopedia, we previously developed several techniques to prepare and select full-length cDNAs. To increase the number of different cDNAs, we introduce here a strategy to prepare normalized and subtracted cDNA libraries in a single step. The method is based on hybridization of the first-strand, full-length cDNA with several RNA drivers, including starting mRNA as the normalizing driver and run-off transcripts from minilibraries containing highly expressed genes, rearrayed clones, and previously sequenced cDNAs as subtracting drivers. Our method keeps the proportion of full-length cDNAs in the subtracted/normalized library high. Moreover, our method dramatically enhances the discovery of new genes as compared to results obtained by using standard, full-length cDNA libraries. This procedure can be extended to the preparation of full-length cDNA encyclopedias from other organisms.
The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3' end and 5' end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month.
The recently defined DEG/ENaC superfamily of sodium channels includes subunits of the amiloride-sensitive epithelial sodium channel (ENaC) of vertebrate colon, lung, kidney, and tongue, a molluscan FMRFamide-gated channel (FaNaC), and the nematode degenerins, which are suspected mechanosensory channels. We have identified two new members of this superfamily (BNaC1 and BNaC2) in a human brain cDNA library. Phylogenetic analysis indicates they are equally divergent from all other members of the DEG/ENaC superfamily and form a new branch or family. Human BNaC1 maps to 17q11.2-12 and hBNaC2 maps to 12q12. Northern blot and mouse brain in situ hybridizations indicate that both genes are coexpressed in most if not all brain neurons, although their patterns of expression vary slightly, and are expressed early in embryogenesis and throughout life. By analogy to the ENaCs and the degenerins, which form heteromultimeric channels, BNaC1 and BNaC2 may be subunits of the same channel.
Large-scale sequencing of cDNAs randomly picked from libraries has proven to be a very powerful approach to discover (putatively) expressed sequences that, in turn, once mapped, may greatly expedite the process involved in the identification and cloning of human disease genes. However, the integrity of the data and the pace at which novel sequences can be identified depends to a great extent on the cDNA libraries that are used. Because altogether, in a typical cell, the mRNAs of the prevalent and intermediate frequency classes comprise as much as 50-65% of the total mRNA mass, but represent no more than 1000-2000 different mRNAs, redundant identification of mRNAs of these two frequency classes is destined to become overwhelming relatively early in any such random gene discovery programs, thus seriously compromising their cost-effectiveness. With the goal of facilitating such efforts, previously we developed a method to construct directionally cloned normalized cDNA libraries and applied it to generate infant brain (INIB) and fetal liver/spleen (INFLS) libraries, from which a total of 45,192 and 86,088 expressed sequence tags, respectively, have been derived. While improving the representation of the longest cDNAs in our libraries, we developed three additional methods to normalize cDNA libraries and generated over 35 libraries, most of which have been contributed to our integrated Molecular Analysis of Genomes and Their Expression (IMAGE) Consortium and thus distributed widely and used for sequencing and mapping. In an attempt to facilitate the process of gene discovery further, we have also developed a subtractive hybridization approach designed specifically to eliminate (or reduce significantly the representation of) large pools of arrayed and (mostly) sequenced clones from normalized libraries yet to be (or just partly) surveyed. Here we present a detailed description and a comparative analysis of four methods that we developed and used to generate normalize cDNA libraries from human (15), mouse (3), rat (2), as well as the parasite Schistosoma mansoni (1). In addition, we describe the construction and preliminary characterization of a subtracted liver/spleen library (INFLS-SI) that resulted from the elimination (or reduction of representation) of -5000 INFLS-IMAGE clones from the INFLS library.