Acads | GeneID:11409 | Mus musculus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 11409 | Official Symbol | Acads |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | AI196007; Bcd-1; Bcd1; SCAD | ||
| Full Name | acyl-Coenzyme A dehydrogenase, short chain | ||
| Description | acyl-Coenzyme A dehydrogenase, short chain | ||
| Chromosome | 5 F|5 65.0 cM | ||
| Also Known As | OTTMUSP00000015526; short-chain acyl-CoA dehydrogenase | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 20057
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:35 | ACADS | NP_000008.1 | Homo sapiens |
| GeneID:11409 | Acads | NP_031409.2 | Mus musculus |
| GeneID:42364 | Arc42 | NP_650840.1 | Drosophila melanogaster |
| GeneID:64304 | Acads | NP_071957.1 | Rattus norvegicus |
| GeneID:416969 | ACADS | NP_001006193.1 | Gallus gallus |
| GeneID:445288 | acads | NP_001003743.1 | Danio rerio |
| GeneID:477517 | ACADS | XP_534712.2 | Canis lupus familiaris |
| GeneID:511222 | ACADS | NP_001029573.1 | Bos taurus |
| GeneID:742921 | ACADS | XP_001162935.1 | Pan troglodytes |
| GeneID:1281174 | AgaP_AGAP001951 | XP_321112.2 | Anopheles gambiae |
| GeneID:100149613 | LOC100149613 | XP_001920717.1 | Danio rerio |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005739 | Component | mitochondrion |
| GO:0003995 | Function | acyl-CoA dehydrogenase activity |
| GO:0004085 | Function | butyryl-CoA dehydrogenase activity |
| GO:0009055 | Function | electron carrier activity |
| GO:0050660 | Function | FAD binding |
| GO:0016491 | Function | oxidoreductase activity |
| GO:0016627 | Function | oxidoreductase activity, acting on the CH-CH group of donors |
| GO:0006631 | Process | fatty acid metabolic process |
| GO:0006629 | Process | lipid metabolic process |
| GO:0008152 | Process | metabolic process |
| GO:0055114 | Process | oxidation reduction |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSMUST00000031524 | MI0000779 | hsa-miR-371-5p | ACUCAAACUGUGGGGGCACU |
| ENSMUST00000031524 | MI0003186 | hsa-miR-502-3p | AAUGCACCUGGGCAAGGAUUCA |
| ENSMUST00000031524 | MI0003186 | hsa-miR-502-5p | AUCCUUGCUAUCUGGGUGCUA |
| ENSMUST00000031524 | MI0003163 | hsa-miR-521 | AACGCACUUCCCUUUAGAGUGU |
| ENSMUST00000031524 | MI0003176 | hsa-miR-521 | AACGCACUUCCCUUUAGAGUGU |
| ENSMUST00000031524 | MI0003153 | hsa-miR-523 | GAACGCGCUUCCCUAUAGAGGGU |
| ENSMUST00000031524 | MI0003679 | hsa-miR-549 | UGACAACUAUGGAUGAGCUCU |
| ENSMUST00000031524 | MI0003557 | hsa-miR-552 | AACAGGUGACUGGUUAGACAA |
| ENSMUST00000031524 | MI0003590 | hsa-miR-583 | CAAAGAGGAAGGUCCCAUUAC |
| ENSMUST00000031524 | MI0003631 | hsa-miR-617 | AGACUUCCCAUUUGAAGGUGGC |
| ENSMUST00000031524 | MI0003636 | hsa-miR-622 | ACAGUCUGCUGAGGUUGGAGC |
| ENSMUST00000031524 | MI0003643 | hsa-miR-629 | UGGGUUUACGUUGGGAGAACU |
| ENSMUST00000031524 | MI0003655 | hsa-miR-640 | AUGAUCCAGGAACCUGCCUCU |
| ENSMUST00000031524 | MI0003665 | hsa-miR-650 | AGGAGGCAGCGCUCUCAGGAC |
| ENSMUST00000031524 | MI0003836 | hsa-miR-766 | ACUCCAGCCCCACAGCCUCAGC |
| ENSMUST00000031524 | MI0005537 | hsa-miR-888 | UACUCAAAAAGCUGUCAGUCA |
| ENSMUST00000031524 | MI0005713 | hsa-miR-921 | CUAGUGAGGGACAGAACCAGGAUUC |
| ENSMUST00000031524 | MI0005714 | hsa-miR-922 | GCAGCAGAGAAUAGGACUACGUC |
| ENSMUST00000031524 | MI0005755 | hsa-miR-933 | UGUGCGCAGGGAGACCUCUCCC |
| ENSMUST00000031524 | MI0005759 | hsa-miR-937 | AUCCGCGCUCUGACUCUCUGCC |
| ENSMUST00000031524 | MI0000137 | mmu-let-7g | UGAGGUAGUAGUUUGUACAGUU |
| ENSMUST00000031524 | MI0000148 | mmu-miR-101a | UACAGUACUGUGAUAACUGAA |
| ENSMUST00000031524 | MI0000649 | mmu-miR-101b | UACAGUACUGUGAUAGCUGAA |
| ENSMUST00000031524 | MI0000587 | mmu-miR-103 | AGCAGCAUUGUACAGGGCUAUGA |
| ENSMUST00000031524 | MI0000588 | mmu-miR-103 | AGCAGCAUUGUACAGGGCUAUGA |
| ENSMUST00000031524 | MI0000684 | mmu-miR-107 | AGCAGCAUUGUACAGGGCUAUCA |
| ENSMUST00000031524 | MI0000151 | mmu-miR-125a-3p | ACAGGUGAGGUUCUUGGGAGCC |
| ENSMUST00000031524 | MI0000151 | mmu-miR-125a-5p | UCCCUGAGACCCUUUAACCUGUGA |
| ENSMUST00000031524 | MI0000152 | mmu-miR-125b-5p | UCCCUGAGACCCUAACUUGUGA |
| ENSMUST00000031524 | MI0000725 | mmu-miR-125b-5p | UCCCUGAGACCCUAACUUGUGA |
| ENSMUST00000031524 | MI0000154 | mmu-miR-127* | CUGAAGCUCAGAGGGCUCUGAU |
| ENSMUST00000031524 | MI0000693 | mmu-miR-139-5p | UCUACAGUGCACGUGUCUCCAG |
| ENSMUST00000031524 | MI0000687 | mmu-miR-17* | ACUGCAGUGAGGGCACUUGUAG |
| ENSMUST00000031524 | MI0000226 | mmu-miR-184 | UGGACGGAGAACUGAUAAGGGU |
| ENSMUST00000031524 | MI0000230 | mmu-miR-188-3p | CUCCCACAUGCAGGGUUUGCA |
| ENSMUST00000031524 | MI0000567 | mmu-miR-18a* | ACUGCCCUAAGUGCUCCUUCUG |
| ENSMUST00000031524 | MI0000247 | mmu-miR-204 | UUCCCUUUGUCAUCCUAUGCCU |
| ENSMUST00000031524 | MI0000569 | mmu-miR-21* | CAACAGCAGUCGAUGGGCUGUC |
| ENSMUST00000031524 | MI0000974 | mmu-miR-215 | AUGACCUAUGAUUUGACAGAC |
| ENSMUST00000031524 | MI0000578 | mmu-miR-27a | UUCACAGUGGCUAAGUUCCGC |
| ENSMUST00000031524 | MI0000388 | mmu-miR-290-5p | ACUCAAACUAUGGGGGCACUUU |
| ENSMUST00000031524 | MI0000389 | mmu-miR-291a-5p | CAUCAAAGUGGAGGCCCUCUCU |
| ENSMUST00000031524 | MI0000390 | mmu-miR-292-5p | ACUCAAACUGGGGGCUCUUUUG |
| ENSMUST00000031524 | MI0000391 | mmu-miR-293* | ACUCAAACUGUGUGACAUUUUG |
| ENSMUST00000031524 | MI0000393 | mmu-miR-295* | ACUCAAAUGUGGGGCACACUUC |
| ENSMUST00000031524 | MI0000576 | mmu-miR-29a* | ACUGAUUUCUUUUGGUGUUCAG |
| ENSMUST00000031524 | MI0000615 | mmu-miR-337-3p | UUCAGCUCCUAUAUGAUGCCU |
| ENSMUST00000031524 | MI0000643 | mmu-miR-351 | UCCCUGAGGAGCCCUUUGAGCCUG |
| ENSMUST00000031524 | MI0004637 | mmu-miR-423-3p | AGCUCGGUCUGAGGCCCCUCAGU |
| ENSMUST00000031524 | MI0004637 | mmu-miR-423-5p | UGAGGGGCAGAGAGCGAGACUUU |
| ENSMUST00000031524 | MI0002398 | mmu-miR-463 | UGAUAGACACCAUAUAAGGUAG |
| ENSMUST00000031524 | MI0004633 | mmu-miR-488 | UUGAAAGGCUGUUUCUUGGUC |
| ENSMUST00000031524 | MI0004702 | mmu-miR-500 | AAUGCACCUGGGCAAGGGUUCA |
| ENSMUST00000031524 | MI0004703 | mmu-miR-501-3p | AAUGCACCCGGGCAAGGAUUUG |
| ENSMUST00000031524 | MI0004553 | mmu-miR-666-5p | AGCGGGCACAGCUGUGAGAGCC |
| ENSMUST00000031524 | MI0004295 | mmu-miR-670 | AUCCCUGAGUGUAUGUGGUGAA |
| ENSMUST00000031524 | MI0004601 | mmu-miR-673-5p | CUCACAGCUCUGGUCCUUGGAG |
| ENSMUST00000031524 | MI0004611 | mmu-miR-674 | GCACUGAGAUGGGAGUGGUGUA |
| ENSMUST00000031524 | MI0004635 | mmu-miR-678 | GUCUCGGUGCAAGGACUGGAGG |
| ENSMUST00000031524 | MI0004643 | mmu-miR-681 | CAGCCUCGCUGGCAGGCAGCU |
| ENSMUST00000031524 | MI0004654 | mmu-miR-689 | CGUCCCCGCUCGGCGGGGUCC |
| ENSMUST00000031524 | MI0004655 | mmu-miR-689 | CGUCCCCGCUCGGCGGGGUCC |
| ENSMUST00000031524 | MI0004662 | mmu-miR-693-3p | GCAGCUUUCAGAUGUGGCUGUAA |
| ENSMUST00000031524 | MI0004691 | mmu-miR-707 | CAGUCAUGCCGCUUGCCUACG |
| ENSMUST00000031524 | MI0004694 | mmu-miR-710 | CCAAGUCUUGGGGAGAGUUGAG |
| ENSMUST00000031524 | MI0004696 | mmu-miR-712* | UGCGAGUCACCCCCGGGUGUUG |
| ENSMUST00000031524 | MI0004698 | mmu-miR-713 | UGCACUGAAGGCACACAGC |
| ENSMUST00000031524 | MI0004700 | mmu-miR-715 | CUCCGUGCACACCCCCGCGUG |
| ENSMUST00000031524 | MI0004129 | mmu-miR-758 | UUUGUGACCUGGUCCACUA |
| ENSMUST00000031524 | MI0005472 | mmu-miR-879 | AGAGGCUUAUAGCUCUAAGCC |
| ENSMUST00000031524 | MI0005477 | mmu-miR-883b-5p | UACUGAGAAUGGGUAGCAGUCA |
| ENSMUST00000031524 | MI0000147 | mmu-miR-99b* | CAAGCUCGUGUCUGUGGGUCCG |
| ENSMUST00000031524 | MI0000636 | rno-miR-349 | CAGCCCUGCUGUCUUAACCUCU |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Stylianou IM, et al. (2008) "Applying gene expression, proteomics and single-nucleotide polymorphism analysis for complex trait gene identification." Genetics. 178(3):1795-1805. PMID:18245842 - [
] Schuler AM, et al. (2005) "Synergistic heterozygosity in mice with inherited enzyme deficiencies of mitochondrial fatty acid beta-oxidation." Mol Genet Metab. 85(1):7-11. PMID:15862275 - [
] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072 - [
] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073 - [
] Smith Richards BK, et al. (2004) "Mice bearing Acads mutation display altered postingestive but not 5-s orosensory response to dietary fat." Am J Physiol Regul Integr Comp Physiol. 286(2):R311-R319. PMID:14592933 - [
] Schuler AM, et al. (2004) "Influence of dietary fatty acid chain-length on metabolic tolerance in mouse models of inherited defects in mitochondrial fatty acid beta-oxidation." Mol Genet Metab. 83(4):322-329. PMID:15589119 - [
] Giesen K, et al. (2003) "Diet-dependent obesity and hypercholesterolemia in the New Zealand obese mouse: identification of a quantitative trait locus for elevated serum cholesterol on the distal mouse chromosome 5." Biochem Biophys Res Commun. 304(4):812-817. PMID:12727230 - [
] Pedersen CB, et al. (2003) "Misfolding, degradation, and aggregation of variant proteins. The molecular pathogenesis of short chain acyl-CoA dehydrogenase (SCAD) deficiency." J Biol Chem. 278(48):47449-47458. PMID:14506246 - [
] Mootha VK, et al. (2003) "Integrated analysis of protein composition, tissue diversity, and gene regulation in mouse mitochondria." Cell. 115(5):629-640. PMID:14651853 - [
] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851 - [
] Andresen BS, et al. (2000) "Characterization of mouse Clpp protease cDNA, gene, and protein." Mamm Genome. 11(4):275-280. PMID:10754102 - [
] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159 - [
] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861 - [
] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636 - [
] Wood PA, et al. (1999) "Lessons learned from the mouse model of short-chain acyl-CoA dehydrogenase deficiency." Adv Exp Med Biol. 466():395-402. PMID:10709668 - [
] Guerra C, et al. (1998) "Abnormal nonshivering thermogenesis in mice with inherited defects of fatty acid oxidation." J Clin Invest. 102(9):1724-1731. PMID:9802886 - [
] Kurtz DM, et al. (1998) "Targeted disruption of mouse long-chain acyl-CoA dehydrogenase gene reveals crucial roles for fatty acid oxidation." Proc Natl Acad Sci U S A. 95(26):15592-15597. PMID:9861014 - [
] Gragnoli C, et al. (1997) "Maturity-onset diabetes of the young due to a mutation in the hepatocyte nuclear factor-4 alpha binding site in the promoter of the hepatocyte nuclear factor-1 alpha gene." Diabetes. 46(10):1648-1651. PMID:9313764 - [
] Bussoli TJ, et al. (1997) "Localization of the bronx waltzer (bv) deafness gene to mouse chromosome 5." Mamm Genome. 8(10):714-717. PMID:9321462 - [
] Pontoglio M, et al. (1996) "Hepatocyte nuclear factor 1 inactivation results in hepatic dysfunction, phenylketonuria, and renal Fanconi syndrome." Cell. 84(4):575-585. PMID:8598044 - [
] Kelly CL, et al. (1996) "Cloning and characterization of the mouse short-chain acyl-CoA dehydrogenase gene." Mamm Genome. 7(4):262-264. PMID:8661694 - [
] Reue K, et al. (1996) "Acads gene deletion in BALB/cByJ mouse strain occurred after 1981 and is not present in BALB/cByJ-fld mutant mice." Mamm Genome. 7(9):694-695. PMID:8703125 - [
] Hinsdale ME, et al. (1996) "Effects of short-chain acyl-CoA dehydrogenase deficiency on development expression of metabolic enzyme genes in the mouse." Biochem Mol Med. 57(2):106-115. PMID:8733888 - [
] Maichele AJ, et al. (1994) "The gamma phosphorylase kinase gene, Phkg, maps to mouse chromosome 5 near Gus." Mamm Genome. 5(1):15-18. PMID:8111123 - [
] Kelly CL, et al. (1993) "Cloning and characterization of the mouse short-chain acyl-CoA dehydrogenase cDNA." Genomics. 18(1):137-140. PMID:8276399 - [
] Armstrong DL, et al. (1993) "Pathologic characterization of short-chain acyl-CoA dehydrogenase deficiency in BALB/cByJ mice." Am J Med Genet. 47(6):884-892. PMID:8279487 - [
] Hinsdale ME, et al. (1993) "Null allele at Bcd-1 locus in BALB/cByJ mice is due to a deletion in the short-chain acyl-CoA dehydrogenase gene and results in missplicing of mRNA." Genomics. 16(3):605-611. PMID:8325633 - [
] Qureshi IA, et al. (1993) "Breeding experiments to combine the X-linked sparse-fur (spf) mutation with the autosomal recessive BALB/cByJ strain: testing the biochemical phenotype of double-mutant mice as a model for ammonia: fatty acyl CoA synergism." Biochem Biophys Res Commun. 191(2):744-749. PMID:8461026 - [
] Kuo CJ, et al. (1990) "Molecular cloning, functional expression, and chromosomal localization of mouse hepatocyte nuclear factor 1." Proc Natl Acad Sci U S A. 87(24):9838-9842. PMID:2263635 - [
] Schiffer SP, et al. (1989) "Organic aciduria and butyryl CoA dehydrogenase deficiency in BALB/cByJ mice." Biochem Genet. 27(1-2):47-58. PMID:2712823 - [
] Patarca R, et al. (1989) "Structural and functional studies of the early T lymphocyte activation 1 (Eta-1) gene. Definition of a novel T cell-dependent response associated with genetic resistance to bacterial infection." J Exp Med. 170(1):145-161. PMID:2787378 - [
] Wood PA, et al. (1989) "Short-chain acyl-coenzyme A dehydrogenase deficiency in mice." Pediatr Res. 25(1):38-43. PMID:2919115 - [
] Winchester G, et al. (1987) "The structural gene for F liver protein (Flp) maps to chromosome 5 of the mouse." Immunogenetics. 26(6):356-358. PMID:3478306 - [
] Seeley TL, et al. (1981) "Genetics and ontogeny of butyryl CoA dehydrogenase in the mouse and linkage of Bcd-1 with Dao-1." Biochem Genet. 19(3-4):333-345. PMID:7247936
Previous quantitative trait locus (QTL) analysis of an intercross involving the inbred mouse strains NZB/BlNJ and SM/J revealed QTL for a variety of complex traits. Many QTL have large intervals containing hundreds of genes, and methods are needed to rapidly sort through these genes for probable candidates. We chose nine QTL: the three most significant for high-density lipoprotein (HDL) cholesterol, gallstone formation, and obesity. We searched for candidate genes using three different approaches: mRNA microarray gene expression technology to assess >45,000 transcripts, publicly available SNPs to locate genes that are not identical by descent and that contain nonsynonymous coding differences, and a mass-spectrometry-based proteomics technology to interrogate nearly 1000 proteins for differential expression in the liver of the two parental inbred strains. This systematic approach reduced the number of candidate genes within each QTL from hundreds to a manageable list. Each of the three approaches selected candidates that the other two approaches missed. For example, candidate genes such as Apoa2 and Acads had differential protein levels although the mRNA levels were similar. We conclude that all three approaches are important and that focusing on a single approach such as mRNA expression may fail to identify a QTL gene.
We have used mice with inborn errors of mitochondrial fatty acid beta-oxidation to test the concept of synergistic heterozygosity. We postulated that clinical disease can result from heterozygous mutations in more than one gene in single or related metabolic pathways. Mice with combinations of mutations in mitochondrial fatty acid beta-oxidation genes were cold challenged to test their ability to maintain normal body temperature, a sensitive indicator of overall beta-oxidation function. This included mice of the following genotypes: triple heterozygosity for mutations in very-long-chain acyl CoA dehydrogenase, long-chain acyl CoA dehydrogenase, and short-chain acyl CoA dehydrogenase genes (VLCAD+/-//LCAD+/-//SCAD+/-); double heterozygosity for mutations in VLCAD and LCAD genes (VLCAD+/-//LCAD+/-); double heterozygosity for mutations in LCAD and SCAD genes (LCAD+/-//SCAD+/-); single heterozygous mice (VLCAD+/-, LCAD+/-, SCAD+/-) and wild-type. We found that approximately 33% of mice with any of the combined mutant genotypes tested became hypothermic during a cold challenge. All wild-type and single heterozygous mice maintained normal body temperature throughout a cold challenge. Despite development of hypothermia in some double heterozygous mice, blood glucose concentrations remained normal. Biochemical screening by acylcarnitine and fatty acid analyses demonstrated results that varied by genotype. Thus, physiologic reduction of the beta-oxidation pathway, characterized as cold intolerance, occurred in mice with double or triple heterozygosity; however, the derangement was milder than in mice homozygous for any of these mutations. These results substantiate the concept of synergistic heterozygosity and illustrate the potential complexity involved in diagnosis and characterization of inborn errors of fatty acid metabolism in humans.
This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins. Genomic mapping of the transcriptome reveals transcriptional forests, with overlapping transcription on both strands, separated by deserts in which few transcripts are observed. The data provide a comprehensive platform for the comparative analysis of mammalian transcriptional regulation in differentiation and development.
Antisense transcription (transcription from the opposite strand to a protein-coding or sense strand) has been ascribed roles in gene regulation involving degradation of the corresponding sense transcripts (RNA interference), as well as gene silencing at the chromatin level. Global transcriptome analysis provides evidence that a large proportion of the genome can produce transcripts from both strands, and that antisense transcripts commonly link neighboring "genes" in complex loci into chains of linked transcriptional units. Expression profiling reveals frequent concordant regulation of sense/antisense pairs. We present experimental evidence that perturbation of an antisense RNA can alter the expression of sense messenger RNAs, suggesting that antisense transcription contributes to control of transcriptional outputs in mammals.
A previous survey of mouse inbred strains revealed a wide range in self-selected fat intake, from 26 to 83% of energy. The BALB/cByJ strain selected a lower percentage of fat intake (36%) than all other strains tested except for the CAST/Ei. BALB/cByJ mice are deficient in the short-chain acyl-CoA dehydrogenase (SCAD) enzyme due to a spontaneous mutation in Acads. We hypothesized that this deficiency would alter fat appetite and used three behavioral test paradigms to compare the response of BALB/cByKz.Acads -/- and BALB/cByKz.Acads +/+ mice to fat stimuli. First, during 10-day exposure to a macronutrient self-selection diet, Acads -/- mice consumed proportionately less fat and more carbohydrate than Acads +/+ mice, yet total energy intake was similar between strains. Next, in 48-h two-bottle preference tests, Acads +/+ mice displayed a preference for 50% corn oil, but Acads -/- mice did not. Finally, in brief-access taste tests employing successive 5-s presentations of corn oil in an ascending concentration series ending with 50%, there were no effects of strain on total licks, indicating that Acads does not alter acute orosensory response to this fat stimulus. With 15-s presentations, however, the Acads +/+ mice licked more of the 50% oil than Acads -/-, suggesting orosensory effects related to the increased exposure time. In contrast to corn oil, there were no strain differences in licking response to sucrose solution in either the two-bottle or brief-access taste tests. The observation that SCAD-deficient mice display altered postingestive responses to dietary fat provides further evidence for the metabolic control of feeding.
Fasting-induced metabolic disease of all inherited deficiencies of the acyl-CoA dehydrogenases is characterized by hypoglycemia, hypoketonemia, and organic aciduria. Mice with these enzyme deficiencies are cold intolerant. To evaluate the potential role that dietary fatty acid chain-length has on a patient's ability to compensate during a metabolic challenge, we fed long-chain acyl CoA dehydrogenase (LCAD) deficient and short-chain acyl CoA dehydrogenase (SCAD) deficient mice a diet rich in medium-chain triglycerides (MCT) or long-chain triglycerides (LCT). To elucidate the importance of maintaining adequate serum glucose concentrations on compensation mechanisms during metabolic challenge, we treated LCAD-/- mice with a solution of 12.5% glucose or saline prior to fasting and a cold-challenge. We found that feeding SCAD deficient mice the LCT diet from weaning increased survival from 40 to 94% during metabolic challenge of cold tolerance. In contrast, there was no benefit to feeding the MCT diet at weaning to LCAD-/- mice; however, there was significant benefit when LCAD-/- mice were fed the MCT diet from the beginning of gestation. Survival during cold-challenge increased from 50 to 93%. In the LCAD-/- mice treated with glucose, despite maintaining serum glucose concentrations at normal or higher concentrations, the LCAD-/- mice were still unable to compensate during metabolic challenge. These results indicate the important influences dietary fatty acids may have by providing enhanced metabolic tolerance in patients with inborn errors of fatty acid oxidation. Furthermore, these studies demonstrate that there may be crucial variables involved in the treatment of these patients, including the patient's specific enzyme deficiency, the quantity and chain-length of dietary fat, which may provide positive effects, as well as the time in development when it was administered.
AIMS: New Zealand obese (NZO) mice exhibit a polygenic syndrome of obesity, insulin resistance, and hypercholesterolemia that resembles the human metabolic syndrome. This study was performed in order to locate genes responsible for elevated serum cholesterol and to compare their effects under a standard and high fat diet.METHODS: A backcross population of NZO with SJL mice (NZO x F1(SJL x NZO)) was generated. Mice were raised on a normal or high fat diet and were monitored for 22 weeks (body weight, serum cholesterol, and blood glucose). A genome-wide scan was performed by genotyping of approximately 200 polymorphic microsatellite markers by PCR and linkage analysis was performed with the MAPMAKER program.RESULTS: In the genome-wide scan, a single susceptibility locus for hypercholesterolemia (Chol1/NZO, maximum LOD score 14.5 in a combined population of 523 backcross mice) was identified on chromosome 5. Cholesterol levels were significantly elevated in both male and female homozygous carriers of the Chol1/NZO allele. The locus maps 40cM distal of the previously described obesity locus Nob1 in the vicinity of the marker D5Mit244 and in the vicinity of hypercholesterolemia QTL previously identified in the NZB, CAST, and C57BL/6J strains. Chol1/NZO was not associated with elevated body weight, serum insulin, or hyperglycemia. The high fat diet significantly increased serum cholesterol levels, but the fat content of the diet did not alter the absolute effect of Chol1/NZO.Conclusions: Chol1/NZO is a major susceptibility locus on the distal mouse chromosome 5, which produces gender-independent hypercholesterolemia in NZO mice. The effect of Chol1/NZO was independent of the dietary fat content and was not associated with the other traits of the metabolic syndrome. Thus, it is suggested that the responsible gene might be involved in cholesterol metabolism.
Short chain acyl-CoA dehydrogenase (SCAD) deficiency is an inborn error of the mitochondrial fatty acid metabolism caused by rare variations as well as common susceptibility variations in the SCAD gene. Earlier studies have shown that a common variant SCAD protein (R147W) was impaired in folding, and preliminary experiments suggested that the variant protein displayed prolonged association with chaperonins and delayed formation of active enzyme. Accordingly, the molecular pathogenesis of SCAD deficiency may rely on intramitochondrial protein quality control mechanisms, including degradation and aggregation of variant SCAD proteins. In this study we investigated the processing of a set of disease-causing variant SCAD proteins (R22W, G68C, W153R, R359C, and Q341H) and two common variant proteins (R147W and G185S) that lead to reduced SCAD activity. All SCAD proteins, including the wild type, associate with mitochondrial hsp60 chaperonins; however, the variant SCAD proteins remained associated with hsp60 for prolonged periods of time. Biogenesis experiments at two temperatures revealed that some of the variant proteins (R22W, G68C, W153R, and R359C) caused severe misfolding, whereas others (R147W, G185S, and Q341H) exhibited a less severe temperature-sensitive folding defect. Based on the magnitude of in vitro defects, these SCAD proteins are characterized as folding-defective variants and mild folding variants, respectively. Pulse-chase experiments demonstrated that the variant SCAD proteins either triggered proteolytic degradation by mitochondrial proteases or, especially at elevated temperature, aggregation of non-native conformers. The latter finding may indicate that accumulation of aggregated SCAD proteins may play a role in the pathogenesis of SCAD deficiency.
Mitochondria are tailored to meet the metabolic and signaling needs of each cell. To explore its molecular composition, we performed a proteomic survey of mitochondria from mouse brain, heart, kidney, and liver and combined the results with existing gene annotations to produce a list of 591 mitochondrial proteins, including 163 proteins not previously associated with this organelle. The protein expression data were largely concordant with large-scale surveys of RNA abundance and both measures indicate tissue-specific differences in organelle composition. RNA expression profiles across tissues revealed networks of mitochondrial genes that share functional and regulatory mechanisms. We also determined a larger "neighborhood" of genes whose expression is closely correlated to the mitochondrial genes. The combined analysis identifies specific genes of biological interest, such as candidates for mtDNA repair enzymes, offers new insights into the biogenesis and ancestry of mammalian mitochondria, and provides a framework for understanding the organelle's contribution to human disease.
Only a small proportion of the mouse genome is transcribed into mature messenger RNA transcripts. There is an international collaborative effort to identify all full-length mRNA transcripts from the mouse, and to ensure that each is represented in a physical collection of clones. Here we report the manual annotation of 60,770 full-length mouse complementary DNA sequences. These are clustered into 33,409 'transcriptional units', contributing 90.1% of a newly established mouse transcriptome database. Of these transcriptional units, 4,258 are new protein-coding and 11,665 are new non-coding messages, indicating that non-coding RNA is a major component of the transcriptome. 41% of all transcriptional units showed evidence of alternative splicing. In protein-coding transcripts, 79% of splice variations altered the protein product. Whole-transcriptome analyses resulted in the identification of 2,431 sense-antisense pairs. The present work, completely supported by physical clones, provides the most comprehensive survey of a mammalian transcriptome so far, and is a valuable resource for functional genomics.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
The RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full-length complementary DNAs and physical mapping of the corresponding genes to the mouse genome. We organized an international functional annotation meeting (FANTOM) to annotate the first 21,076 cDNAs to be analysed in this project. Here we describe the first RIKEN clone collection, which is one of the largest described for any organism. Analysis of these cDNAs extends known gene families and identifies new ones.
Mutations that cause accumulation or rapid degradation owing to protein misfolding are a frequent cause of inherited disease in humans. In Escherichia coli, Clpp protease is one of the components of the protein quality control system that handles misfolded proteins. In the present study, we have characterized the mouse Clpp cDNA sequence, the organization of the mouse gene, the chromosomal localization, and the tissue-specific expression pattern. Moreover. the cellular localization and processing of mouse Clpp was studied by overexpression in transfected eukaryotic cells. Our results indicate that mouse and human Clpp have similar roles, and they provide the molecular basis for establishing a Clpp knockout mouse and to study its phenotype, thereby shedding light on a possible role of Clpp in human disease.
In the effort to prepare the mouse full-length cDNA encyclopedia, we previously developed several techniques to prepare and select full-length cDNAs. To increase the number of different cDNAs, we introduce here a strategy to prepare normalized and subtracted cDNA libraries in a single step. The method is based on hybridization of the first-strand, full-length cDNA with several RNA drivers, including starting mRNA as the normalizing driver and run-off transcripts from minilibraries containing highly expressed genes, rearrayed clones, and previously sequenced cDNAs as subtracting drivers. Our method keeps the proportion of full-length cDNAs in the subtracted/normalized library high. Moreover, our method dramatically enhances the discovery of new genes as compared to results obtained by using standard, full-length cDNA libraries. This procedure can be extended to the preparation of full-length cDNA encyclopedias from other organisms.
The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3' end and 5' end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month.
The SCAD deficient mouse model has been useful to investigate mechanisms of deficient fatty acid oxidation disease in human patients. This mouse model has been thoroughly characterized and is readily available from the Jackson Laboratory. Using the new technologies of gene-knockout mouse modeling, we envisage developing additional members of the acyl-CoA dehydrogenase family of enzyme deficiencies in mice and furthering our understanding of fatty acid metabolism in health and disease.
When placed in the cold (4 degreesC), BALB/cByJ mice of both genders rapidly lose body temperature as compared with the control strain, C57BL/6J. This sensitivity to cold resembles that previously described for mice with a defect in nonshivering thermogenesis due to the targeted inactivation of the brown adipocyte-specific mitochondrial uncoupling protein gene, Ucp1. Genetic mapping of the trait placed the gene on chromosome 5 near Acads, a gene encoding the short chain acyl CoA dehydrogenase, which is mutated in BALB/cByJ mice. The analysis of candidate genes in the region indicated a defect only in the expression of Acads. Confirmation of the importance of fatty acid oxidation to thermogenesis came from our finding that mice carrying the targeted inactivation of the long chain acyl CoA dehydrogenase gene (Acadl) are also sensitive to the cold. Both of these mutations attenuate the induction of genes normally responsive to adrenergic signaling in brown adipocytes. These results suggest that the action of fatty acids as regulators of gene expression has been perturbed in the mutant mice. From a clinical perspective, it is important to determine whether defects in thermogenesis may be a phenotype in human neonates with inherited deficiencies in fatty acid beta-oxidation.
Abnormalities of fatty acid metabolism are recognized to play a significant role in human disease, but the mechanisms remain poorly understood. Long-chain acyl-CoA dehydrogenase (LCAD) catalyzes the initial step in mitochondrial fatty acid oxidation (FAO). We produced a mouse model of LCAD deficiency with severely impaired FAO. Matings between LCAD +/- mice yielded an abnormally low number of LCAD +/- and -/- offspring, indicating frequent gestational loss. LCAD -/- mice that reached birth appeared normal, but had severely reduced fasting tolerance with hepatic and cardiac lipidosis, hypoglycemia, elevated serum free fatty acids, and nonketotic dicarboxylic aciduria. Approximately 10% of adult LCAD -/- males developed cardiomyopathy, and sudden death was observed in 4 of 75 LCAD -/- mice. These results demonstrate the crucial roles of mitochondrial FAO and LCAD in vivo.
Recent studies have shown that mutations in the transcription factor hepatocyte nuclear factor (HNF)-1 alpha are the cause of one form of maturity-onset diabetes of the young (MODY3). These studies have identified mutations in the mRNA and protein coding regions of this gene that result in the synthesis of an abnormal mRNA or protein. Here, we report an Italian family in which an A-->C substitution at nucleotide-58 of the promoter region of the HNF-1 alpha gene cosegregates with MODY. This mutation is located in a highly conserved region of the promoter and disrupts the binding site for the transcription factor HNF-4 alpha, mutations in the gene encoding HNF-4 alpha being another cause of MODY (MODY1). This result demonstrates that decreased levels of HNF-1 alpha per se can cause MODY. Moreover, it indicates that both the promoter and coding regions of the HNF-1 alpha gene should be screened for mutations in subjects thought to have MODY because of mutations in this gene.
The bronx waltzer (bv) mutation is an autosomal recessive mutation that is manifested as head tossing and circling in the mouse. The mutation affects the inner hair cells (IHCs) and pillar cells in the organ of Corti of the cochlea and the maculae and cristae of the vestibular part of the inner ear. IHCs begin to degenerate by a controlled mechanism of cell death as early as gestational day 17 (G17) in the basal coil of the cochlea, and few surviving IHCs are seen in the adult. As a first step towards the identification of bv, we analyzed a total of 20 loci in 118 mice from an intraspecific backcross giving the gene order: centromere-D5Mit1-D5Mit73-D5Mit55-[D5Mit12, Nds4 (Afp)]-D5Mit87-[D5Mit205, 20, 88, 208, 93-D5Mit338]-D5Mit25-D5Mit209-bv-D5Mit188-D5M it367-D5Mit95-D5Mit43-D5Mit102. A total of 701 mice were then analyzed for the markers D5Mit93 and D5Mit95, defining a region of 12.08 cM flanking bv. Mice that were recombinant between D5Mit93 and D5Mit95 were analyzed for D5Mit338, D5Mit25, D5Mit209, bv, D5Mit188, and D5Mit367. bv maps 0.14 cM distal of the marker D5Mit209 and 1.14 cM proximal of the marker D5Mit188 in 701 backcross progeny.
HNF1 is a transcriptional activator of many hepatic genes including albumin, alpha1-antitrypsin, and alpha- and beta-fibrinogen. It is related to the homeobox gene family and is predominantly expressed in liver and kidney. Mice lacking HNF1 fail to thrive and die around weaning after a progressive wasting syndrome with a marked liver enlargement. The transcription rate of genes like albumin and alpha1-antitrypsin is reduced, while the gene coding for phenylalanine hydroxylase is totally silent, giving rise to phenylketonuria. Mutant mice also suffer from severe Fanconi syndrome caused by renal proximal tubular dysfunction. The resulting massive urinary glucose loss leads to energy and water wasting. HNF1-deficient mice may provide a model for human renal Fanconi syndrome.
Short-chain acyl-CoA dehydrogenase (SCAD) is one of four straight-chain length specific enzymes involved in the first step of fatty acid beta-oxidation. To further understand the similarities between the members of this gene family, to characterize how the gene is regulated, and to determine if there is coordinate regulation between these similar genes, we have isolated genomic clones containing the mouse Acads gene. We show that Acads is a compact, single-copy gene approximately 5000 bp in size. We sequenced the entire coding portion of the gene, all of the intron/exon junctions, and an 850-bp segment upstream of the translation start site. We have determined that the gene consists of 10 exons ranging in size from 57 bp to 703 bp, and 9 introns ranging in size from 80 bp to approximately 700 bp. The 5' region of the mouse Acads gene lacks a TATA box or a CAAT box, is GC rich, and also lacks any similarity to the related gene, medium-chain acyl-CoA dehydrogenase. This is the initial report of the gene structure and 5' regulatory sequence of the short-chain acyl-CoA dehydrogenase gene in any species.
Patients with an acyl-CoA dehydrogenase deficiency share the disease features of hypoglycemia, hyperammonemia, tissue fatty change, hypoketonemia, carnitine deficiency, and organic acidemia due to apparent disruption of normal fatty acid, glucose, and urea metabolism. Most of the acute clinical episodes occur in young children. These episodes are precipitated by fasting and are often fatal, with the in vivo mechanisms essentially unknown. Since the genes of the rate controlling enzymes of these pathways are tissue and developmentally regulated at the transcriptional level, we measured, throughout neonatal development, the steady-state mRNA levels of long-chain, medium-chain, and short-chain (SCAD) acyl-CoA dehydrogenases, pyruvate carboxylase (PC), phosphoenolpyruvate carboxykinase (PEPCK), carbamyl phosphate synthetase I (CPS), ornithine transcarbamylase (OTC), and argininosuccinate synthetase (AS) in fed or fasted SCAD-deficient BALB/ByJ mice compared to BALB/cBy controls. Overall, our results showed no major effects on expression of acyl-CoA dehydrogenases due to SCAD deficiency, regardless of age or fasting. In SCAD-deficient mice we found depressed mRNA expression and enzyme activity for the urea cycle enzymes CPS and AS at 6 days of age, and found no apparent effects on expression of gluconeogenic enzymes PC or PEPCK. There was a period of overall lower gene expression for most genes at 6 and 15 days, which appears to be in parallel with the developmental period when children with these diseases are most severely affected.
Phosphorylase kinase is a multimeric regulatory enzyme in the glycogenolytic pathway. Interest in various types of phosphorylase kinase enzyme deficiency has focused attention on cloning and mapping the enzyme subunits. We report the mapping of the catalytic gamma subunit gene, Phkg, to mouse Chromosome (Chr) 5 near beta-glucuronidase (Gus), between alpha fetoprotein (Afp) and erythropoietin (Epo). In addition, PCR-based polymorphism assays have been developed for the human (EPO) and mouse erythropoietin genes, and a unique recombinant inbred strain distribution pattern has been defined for Epo, a distal anchor marker on mouse Chr 5.
Short-chain acyl-CoA dehydrogenase (SCAD) is one of five homologous dehydrogenases that catalyze the first reaction in the beta-oxidation of fatty acids. As the name implies, the substrate for this enzyme is short-chain acyl-CoA (C4-C6). We report here the coding and 3'UT sequence of the cDNA for mouse precursor SCAD. The mouse SCAD cDNA coding sequence covers 1239 bp. This represents a 24-amino-acid leader peptide and a 388-amino-acid mature peptide. Comparison of this sequence with reported rat and human SCAD cDNA sequences reveals a high degree of homology among the three species. Comparison of the amino acid sequence with that of other acyl-CoA dehydrogenases, medium-chain acyl-CoA dehydrogenase and long-chain acyl-CoA dehydrogenase, also shows a high degree of homology.
BALB/cByJ mice have a deficiency of short-chain acyl-CoA dehydrogenase (SCAD) and are a useful model for studying the inborn errors of fatty acid metabolism which affect humans. Patients with some of these disorders present with hypoglycemia, hyperammonemia, and microvesicular fatty change of hepatocytes. In the present study we examined pathogen-free, SCAD deficient BALB/cByJ mice and control BALB/cBy mice for biochemical and tissue changes following fasting or salicylate challenge. We observed mitochondrial swelling and microvesicular fatty changes in hepatocytes in mutant mice, especially severe following a fast. However, fasting did not alter their blood ammonia and there was no apparent clinical disease. Similarly, salicylates did not produce disease in the BALB/cByJ mice. We did detect in mice an alternative pathway for salicylate metabolism, by-passing glycine conjugation which is the principal metabolic pathway in humans.
BALB/cByJ mice have a deficiency of short-chain acyl-CoA dehydrogenase (SCAD), an enzyme of fatty acid beta-oxidation. This mutant mouse strain represents the only animal model for any human inborn error of fatty acid metabolism. We have investigated the molecular basis of this defect by DNA and RNA analyses, comparing these mice with the wild-type predecessor strain BALB/cBy. We found that the mutant strain has a 278-bp deletion in the 3' end of the structural gene for SCAD and reduced steady-state levels of SCAD mRNA. Two major transcripts are produced in the mutant. One contains intronic sequence due to the absence of splicing, and the second transcript results from missplicing of a normal splice donor site to a cryptic splice acceptor site in the 3' terminal exon. Both abnormal transcripts have aberrant stop codons. These results demonstrate the molecular basis of SCAD deficiency in this unique mouse model.
Breeding experiments were conducted to combine the X-linked sparse-fur (spf) mutation with ornithine transcarbamylase deficiency and the autosomal recessive deficiency of short-chain acyl CoA dehydrogenase (SCAD) in BALB/cByJ mice. We obtained spf/Y (scad/scad), spf/+ (scad/scad) and spf/spf (scad/scad) double mutants amongst the F2 progeny, which were tested and separated on the basis of urinary orotate and the GC/MS analysis of urinary butyrylglycine, methylsuccinate and ethylmalonate. The testing of the biochemical type was feasible both on the basis of a 24-h urine collection form adult mice kept in metabolic cages and on the basis of urine spots collected on filter paper from younger progeny. It is postulated that the spf/Y (scad/scad) double-mutant may serve as a useful animal model to study the ammonia: fatty acyl CoA synergism.
The homeodomain-containing transcription factor hepatocyte nuclear factor 1 (HNF-1) most likely plays an essential role during liver organogenesis by transactivating a family of greater than 15 predominantly hepatic genes. We have isolated cDNA clones encoding mouse HNF-1 and expressed them in monkey COS cells and in the human T-cell line Jurkat, producing HNF-1 DNA-binding activity as well as transactivation of reporter constructs containing multimerized HNF-1 binding sites. In addition, the HNF-1 gene was assigned by somatic cell hybrids and recombinant inbred strain mapping to mouse chromosome 5 near Bcd-1 and to human chromosome 12 region q22-qter, revealing a homologous chromosome region in these two species. The presence of HNF-1 mRNA in multiple endodermal tissues (liver, stomach, intestine) suggests that HNF-1 may constitute an early marker for endodermal, rather than hepatocyte, differentiation. Further, that HNF-1 DNA-binding and transcriptional activity can be conferred by transfecting the HNF-1 cDNA into several cell lines indicates that it is sufficient to activate transcription in the context of ubiquitously expressed factors.
A metabolic screening program of inbred strains of mice has detected a marked organic aciduria in the BALB/cByJ strain. Gas chromatographic and mass spectrometric analysis identified large quantities of n-butyrylglycine plus lesser quantities of ethylmalonic acid. Crosses with the nonexcreting C57BL/6J strain indicate that this condition is inherited as an autosomal recessive trait. Independently from this screening a variant with no detectable enzyme activity of butyryl CoA dehydrogenase (BCD) in liver and kidney of the BALB/cByJ strain but not other BALB/c sublines was discovered. Data from a three-point cross indicated that the null variant maps to the structural locus for the enzyme, Bcd-1, on chromosome 5. The findings indicate that a mutation at or near Bcd-1 in the BALB/cByJ strain resulted in a biochemical abnormality manifest as the BCD deficiency. It is concluded that accumulation of butyryl CoA due to a block in the oxidation of short-chain fatty acids results in an overproduction of organic metabolites leading to the observed organic aciduria. The fact that other BALB/c substrains do not exhibit this abnormality further suggests that this disorder reflects subline divergence within the BALB/c family.
We describe a murine cDNA, designated Early T lymphocyte activation 1 (ETA-1) which is abundantly expressed after activation of T cells. Eta-1 encodes a highly acidic secreted product having structural features of proteins that bind to cellular adhesion receptors. The Eta-1 gene maps to a locus on murine chromosome 5 termed Ric that confers resistance to infection by Rickettsia tsutsugamushi (RT), an obligate intracellular bacterium that is the etiological agent for human scrub typhus. With one exception, inbred mouse strains that expressed the Eta-1a allele were resistant to RT infection (RicR), and inbred strains expressing the Eta-1b allele were susceptible (RicS). These findings suggest that Eta-1 is the gene inferred from previous studies of the Ric locus (5). Genetic resistance to RT infection is associated with a strong Eta-1 response in vivo and inhibition of early bacterial replication. Eta-1 gene expression appears to be part of a surprisingly rapid T cell-dependent response to bacterial infection that may precede classical forms of T cell-dependent immunity.
A murine model for short-chain acyl-coenzyme A dehydrogenase (SCAD) deficiency has been identified and characterized in BALB/cByJ mice. These mice have undetectable SCAD activity, severe organic aciduria; excreting ethylmalonic and methylsuccinic acids and N-butyrylglycine, and develop a fatty liver upon fasting or dietary fat challenge. The mutant mice develop hypoglycemia after an 18-h fast, and have elevated urinary and muscle butyrylcarnitine concentrations. Most of these findings parallel those of human disorders associated with SCAD deficiency and other beta-oxidation defects. This mouse model presents important opportunities to investigate the biology of mammalian fatty acid metabolism and the related human diseases.
The BXD and AKXL panels of recombinant inbred mouse strains have been typed for the F liver protein alloantigen. The structural gene for F liver protein gene (Flp) is placed on the distal part of chromosome 5, between the known markers Bcd-1 and Gus-s. This excludes the possibility that F liver protein is a major histocompatibility complex molecule, and in turn raises a question about the uniqueness of F and certain other proteins as purgers of self-reactivity among T but not B cells. The typed RI strains have then been used for the immunogenetic studies presented in the succeeding article.
A zymogram method has been developed for fatty acyl CoA dehydrogenase and used to examine the electrophoretic properties of butyryl CoA dehydrogenase (BCD) from mouse tissues. A single form of BCD is present in extracts of liver, kidney, heart, and intestine. Ontogenetic, tissue distribution, and subcellular fractionation results are consistent with the mitochondrial origin previously reported for this enzyme. A genetic variant for BCD-1 was used to provide evidence for a locus determining the electrophoretic properties of this enzyme (designated Bcd-1), which is linked to Dao-1 (encoding D-amino acid oxidase).