Abl1 | GeneID:11350 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 11350 Official Symbol Abl1
Locus RP23-65P13.3 Gene Type protein-coding
Synonyms AI325092; Abl; E430008G22Rik; MGC117749; c-Abl
Full Name c-abl oncogene 1, receptor tyrosine kinase
Description c-abl oncogene 1, receptor tyrosine kinase
Chromosome 2 B|2 21.0 cM
Also Known As Abelson murine leukemia oncogene; OTTMUSP00000013005; v-abl Abelson murine leukemia oncogene 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3783

ID Symbol Protein Species
GeneID:25 ABL1 NP_009297.2 Homo sapiens
GeneID:11350 Abl1 NP_033724.1 Mus musculus
GeneID:311860 Abl1 XP_001067860.1 Rattus norvegicus
GeneID:417181 ABL1 XP_001233812.1 Gallus gallus
GeneID:464802 ABL1 XP_001166213.1 Pan troglodytes
GeneID:491292 ABL1 XP_548413.2 Canis lupus familiaris
GeneID:540876 ABL1 XP_613548.2 Bos taurus
GeneID:100000720 LOC100000720 XP_001337829.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab63530 c Abl antibody (ab63530); Rabbit polyclonal to c Abl
2 abcam ab62189 c Abl (phospho Y245) antibody (ab62189); Rabbit polyclonal to c Abl (phospho Y245)
3 abcam ab61757 c Abl (phospho Y204) antibody (ab61757); Rabbit polyclonal to c Abl (phospho Y204)
4 abcam ab55284 c Abl (phospho Y412) antibody (ab55284); Rabbit polyclonal to c Abl (phospho Y412)
5 abcam ab54394 c Abl antibody [SPM328], prediluted (ab54394); Mouse monoclonal [SPM328] to c Abl, prediluted
6 abcam ab47410 c Abl antibody (ab47410); Rabbit polyclonal to c Abl
7 abcam ab47315 c Abl (phospho Y412) antibody (ab47315); Rabbit polyclonal to c Abl (phospho Y412)
8 abcam ab4479 c Abl (phospho Y245) antibody (ab4479); Rabbit polyclonal to c Abl (phospho Y245)
9 abcam ab4717 c Abl (phospho Y412) antibody (ab4717); Rabbit polyclonal to c Abl (phospho Y412)
10 abcam ab16903 c Abl antibody [19-110] (ab16903); Mouse monoclonal [19-110] to c Abl
11 abcam ab16905 c Abl antibody [24-21] (ab16905); Mouse monoclonal [24-21] to c Abl
12 abcam ab3227 c Abl antibody [8E9] (ab3227); Mouse monoclonal [8E9] to c Abl
13 abcam ab15130 c Abl antibody (ab15130); Rabbit polyclonal to c Abl
14 abcam ab10528 c Abl antibody [ABL-148] (ab10528); Mouse monoclonal [ABL-148] to c Abl
15 abcam ab15133 c Abl antibody, prediluted (ab15133); Rabbit polyclonal to c Abl, prediluted
16 sigma C5365 Anti-phospho-c-Abl (pTyr245) antibody produced in rabbit ;
17 sigma C5240 Anti-phospho-c-Abl (pTyr412) antibody produced in rabbit ;
18 sigma A5844 Monoclonal Anti-c-Abl antibody produced in mouse ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005856 Component cytoskeleton
GO:0005829 Component cytosol
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0005524 Function ATP binding
GO:0016301 Function kinase activity
GO:0000287 Function magnesium ion binding
GO:0030145 Function manganese ion binding
GO:0046872 Function metal ion binding
GO:0004715 Function non-membrane spanning protein tyrosine kinase activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0019904 Function protein domain specific binding
GO:0004672 Function protein kinase activity
GO:0004713 Function protein tyrosine kinase activity
GO:0016740 Function transferase activity
GO:0030036 Process actin cytoskeleton organization
GO:0007155 Process cell adhesion
GO:0018108 Process peptidyl-tyrosine phosphorylation
GO:0006468 Process protein amino acid phosphorylation
GO:0051726 Process regulation of cell cycle

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001112703  UCSC Browser NP_001106174
2 NM_009594  UCSC Browser NP_033724 P00520   A2AV22   Q3SYK5  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000028190 MI0000714 mmu-miR-199b* CCCAGUGUUUAGACUACCUGUUC
ENSMUST00000028190 MI0000246 mmu-miR-203 GUGAAAUGUUUAGGACCACUAG
ENSMUST00000028190 MI0001524 mmu-miR-431* CAGGUCGUCUUGCAGGGCUUCU
ENSMUST00000028190 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENSMUST00000028190 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU
ENSMUST00000028190 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA
ENSMUST00000028190 MI0000147 mmu-miR-99b CACCCGUAGAACCGACCUUGCG
ENSMUST00000075759 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENSMUST00000075759 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENSMUST00000075759 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSMUST00000075759 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENSMUST00000075759 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSMUST00000075759 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENSMUST00000075759 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENSMUST00000075759 MI0000685 mmu-miR-10a* CAAAUUCGUAUCUAGGGGAAUA
ENSMUST00000075759 MI0000172 mmu-miR-150* CUGGUACAGGCCUGGGGGAUAG
ENSMUST00000075759 MI0000246 mmu-miR-203 GUGAAAUGUUUAGGACCACUAG
ENSMUST00000075759 MI0000763 mmu-miR-362-5p AAUCCUUGGAACCUAGGUGUGAAU
ENSMUST00000075759 MI0000795 mmu-miR-378 ACUGGACUUGGAGUCAGAAGG
ENSMUST00000075759 MI0001146 mmu-miR-384-5p UGUAAACAAUUCCUAGGCAAUGU
ENSMUST00000075759 MI0004605 mmu-miR-760 CGGCUCUGGGUCUGUGGGGA
ENSMUST00000075759 MI0000147 mmu-miR-99b CACCCGUAGAACCGACCUUGCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
Grap2 Grap2 / Abl1 Affinity Capture-Western Liu SK (1998)
Pxn Abl1 / Pxn Affinity Capture-Western Lewis JM (1998)
Pxn Pxn / Abl1 Affinity Capture-Western Lewis JM (1998)
Pxn Abl1 / Pxn Biochemical Activity Lewis JM (1998)
Rin1 Abl1 / Rin1 Biochemical Activity Han L (1997)
Rin1 Abl1 / Rin1 Reconstituted Complex Han L (1997)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Liberatore RA, et al. (2009) "c-Abl-deficient mice exhibit reduced numbers of peritoneal B-1 cells and defects in BCR-induced B cell activation." Int Immunol. 21(4):403-414. PMID:19228876
  2. [ + ] Vazquez MC, et al. (2009) "c-Abl modulates AICD dependent cellular responses: transcriptional induction and apoptosis." J Cell Physiol. 220(1):136-143. PMID:19306298
  3. [ + ] Brightbill H, et al. (2009) "The effects of c-Abl mutation on developing B cell differentiation and survival." Int Immunol. 21(5):575-585. PMID:19299624
  4. [ + ] Huang CC, et al. (2008) "An enhanced association of RACK1 with Abl in cells transfected with oncogenic ras." Int J Biochem Cell Biol. 40(3):423-431. PMID:17881279
  5. [ + ] Huang Y, et al. (2008) "The c-Abl tyrosine kinase regulates actin remodeling at the immune synapse." Blood. 112(1):111-119. PMID:18305217
  6. [ + ] Jia DY, et al. (2008) "c-Abl is involved in high glucose-induced apoptosis in embryonic E12.5 cortical neural progenitor cells from the mouse brain." J Neurochem. 106(4):1720-1730. PMID:18624912
  7. [ + ] Bueno MJ, et al. (2008) "Genetic and epigenetic silencing of microRNA-203 enhances ABL1 and BCR-ABL1 oncogene expression." Cancer Cell. 13(6):496-506. PMID:18538733
  8. [ + ] Kharas MG, et al. (2008) "Ablation of PI3K blocks BCR-ABL leukemogenesis in mice, and a dual PI3K/mTOR inhibitor prevents expansion of human BCR-ABL+ leukemia cells." J Clin Invest. 118(9):3038-3050. PMID:18704194
  9. [ + ] Ganapathipillai SS, et al. (2008) "Coupling of mutated Met variants to DNA repair via Abl and Rad51." Cancer Res. 68(14):5769-5777. PMID:18632630
  10. [ + ] Silberman I, et al. (2008) "T cell survival and function requires the c-Abl tyrosine kinase." Cell Cycle. 7(24):3847-3857. PMID:19098427
  11. [ + ] Fanta S, et al. (2008) "Pharmacological inhibition of c-Abl compromises genetic stability and DNA repair in Bcr-Abl-negative cells." Oncogene. 27(31):4380-4384. PMID:18362889
  12. [ + ] Oh AS, et al. (2008) "Tyrosine phosphorylation of the nuclear receptor coactivator AIB1/SRC-3 is enhanced by Abl kinase and is required for its activity in cancer cells." Mol Cell Biol. 28(21):6580-6593. PMID:18765637
  13. [ + ] Lam QL, et al. (2007) "Impaired V(D)J recombination and increased apoptosis among B cell precursors in the bone marrow of c-Abl-deficient mice." Int Immunol. 19(3):267-276. PMID:17229817
  14. [ + ] Grimmler M, et al. (2007) "Cdk-inhibitory activity and stability of p27Kip1 are directly regulated by oncogenic tyrosine kinases." Cell. 128(2):269-280. PMID:17254966
  15. [ + ] Frasca F, et al. (2007) "Role of c-Abl in directing metabolic versus mitogenic effects in insulin receptor signaling." J Biol Chem. 282(36):26077-26088. PMID:17620332
  16. [ + ] Backer S, et al. (2007) "Trio controls the mature organization of neuronal clusters in the hindbrain." J Neurosci. 27(39):10323-10332. PMID:17898204
  17. [ + ] Preyer M, et al. (2007) "Delayed activation of Bax by DNA damage in embryonic stem cells with knock-in mutations of the Abl nuclear localization signals." Cell Death Differ. 14(6):1139-1148. PMID:17363963
  18. [ + ] Borges HL, et al. (2007) "Reduction of apoptosis in Rb-deficient embryos via Abl knockout." Oncogene. 26(26):3868-3877. PMID:17173068
  19. [ + ] Jin H, et al. (2007) "Abl tyrosine kinase promotes dorsal ruffles but restrains lamellipodia extension during cell spreading on fibronectin." Mol Biol Cell. 18(10):4143-4154. PMID:17686996
  20. [ + ] Sfakianos MK, et al. (2007) "Inhibition of Rho via Arg and p190RhoGAP in the postnatal mouse hippocampus regulates dendritic spine maturation, synapse and dendrite stability, and behavior." J Neurosci. 27(41):10982-10992. PMID:17928439
  21. [ + ] Zhou T, et al. (2007) "Crystal structure of the T315I mutant of AbI kinase." Chem Biol Drug Des. 70(3):171-181. PMID:17718712
  22. [ + ] Krause DS, et al. (2006) "Requirement for CD44 in homing and engraftment of BCR-ABL-expressing leukemic stem cells." Nat Med. 12(10):1175-1180. PMID:16998483
  23. [ + ] Hirao N, et al. (2006) "NESH (Abi-3) is present in the Abi/WAVE complex but does not promote c-Abl-mediated phosphorylation." FEBS Lett. 580(27):6464-6470. PMID:17101133
  24. [ + ] Slupianek A, et al. (2006) "BCR/ABL modifies the kinetics and fidelity of DNA double-strand breaks repair in hematopoietic cells." DNA Repair (Amst). 5(2):243-250. PMID:16297667
  25. [ + ] Wilkes MC, et al. (2006) "Transforming growth factor beta activation of c-Abl is independent of receptor internalization and regulated by phosphatidylinositol 3-kinase and PAK2 in mesenchymal cultures." J Biol Chem. 281(38):27846-27854. PMID:16867995
  26. [ + ] Gao B, et al. (2006) "The tyrosine kinase c-Abl protects c-Jun from ubiquitination-mediated degradation in T cells." J Biol Chem. 281(40):29711-29718. PMID:16901904
  27. [ + ] Stuart JR, et al. (2006) "c-Abl interacts with the WAVE2 signaling complex to induce membrane ruffling and cell spreading." J Biol Chem. 281(42):31290-31297. PMID:16899465
  28. [ + ] Wang X, et al. (2006) "p53 functions as a negative regulator of osteoblastogenesis, osteoblast-dependent osteoclastogenesis, and bone remodeling." J Cell Biol. 172(1):115-125. PMID:16380437
  29. [ + ] Tokonzaba E, et al. (2006) "Phosphoinositide, phosphopeptide and pyridone interactions of the Abl SH2 domain." Chem Biol Drug Des. 67(3):230-237. PMID:16611216
  30. [ + ] Letterio J, et al. (2006) "Transforming growth factor-beta1 sensitivity is altered in Abl-Myc- and Raf-Myc-induced mouse pre-B-cell tumors." Stem Cells. 24(12):2611-2617. PMID:16945999
  31. [ + ] Chen X, et al. (2006) "A kinase-independent function of c-Abl in promoting proteolytic destruction of damaged DNA binding proteins." Mol Cell. 22(4):489-499. PMID:16713579
  32. [ + ] Moresco EM, et al. (2005) "Integrin-mediated dendrite branch maintenance requires Abelson (Abl) family kinases." J Neurosci. 25(26):6105-6118. PMID:15987940
  33. [ + ] Devireddy LR, et al. (2005) "A cell-surface receptor for lipocalin 24p3 selectively mediates apoptosis and iron uptake." Cell. 123(7):1293-1305. PMID:16377569
  34. [ + ] Boureux A, et al. (2005) "Abl tyrosine kinase regulates a Rac/JNK and a Rac/Nox pathway for DNA synthesis and Myc expression induced by growth factors." J Cell Sci. 118(Pt 16):3717-3726. PMID:16076903
  35. [ + ] Lin H, et al. (2005) "Bcr-Abl-mediated suppression of normal hematopoiesis in leukemia." Oncogene. 24(20):3246-3256. PMID:15735695
  36. [ + ] Zhao R, et al. (2005) "GATA6 is essential for embryonic development of the liver but dispensable for early heart formation." Mol Cell Biol. 25(7):2622-2631. PMID:15767668
  37. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  38. [ + ] Woodring PJ, et al. (2005) "Mitotic phosphorylation rescues Abl from F-actin-mediated inhibition." J Biol Chem. 280(11):10318-10325. PMID:15632178
  39. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  40. [ + ] Tzeng SJ, et al. (2005) "The B cell inhibitory Fc receptor triggers apoptosis by a novel c-Abl family kinase-dependent pathway." J Biol Chem. 280(42):35247-35254. PMID:16115887
  41. [ + ] Zeng L, et al. (2005) "Identification of TopBP1 as a c-Abl-interacting protein and a repressor for c-Abl expression." J Biol Chem. 280(32):29374-29380. PMID:15961388
  42. [ + ] Stuart JR, et al. (2005) "c-Abl regulates early growth response protein (EGR1) in response to oxidative stress." Oncogene. 24(55):8085-8092. PMID:16091742
  43. [ + ] Toyofuku T, et al. (2004) "Guidance of myocardial patterning in cardiac development by Sema6D reverse signalling." Nat Cell Biol. 6(12):1204-1211. PMID:15543137
  44. [ + ] Li B, et al. (2004) "Distinct roles of c-Abl and Atm in oxidative stress response are mediated by protein kinase C delta." Genes Dev. 18(15):1824-1837. PMID:15289456
  45. [ + ] Suzuki J, et al. (2004) "Loss of c-abl facilitates anchorage-independent growth of p53- and RB- deficient primary mouse embryonic fibroblasts." Oncogene. 23(52):8527-8534. PMID:15378021
  46. [ + ] Watahiki A, et al. (2004) "Libraries enriched for alternatively spliced exons reveal splicing patterns in melanocytes and melanomas." Nat Methods. 1(3):233-239. PMID:15782199
  47. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  48. [ + ] Woodring PJ, et al. (2004) "c-Abl phosphorylates Dok1 to promote filopodia during cell spreading." J Cell Biol. 165(4):493-503. PMID:15148308
  49. [ + ] Kuribara R, et al. (2004) "Roles of Bim in apoptosis of normal and Bcr-Abl-expressing hematopoietic progenitors." Mol Cell Biol. 24(14):6172-6183. PMID:15226421
  50. [ + ] Blackshaw S, et al. (2004) "Genomic analysis of mouse retinal development." PLoS Biol. 2(9):E247. PMID:15226823