GABARAPL2 | GeneID:11345 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 11345 Official Symbol GABARAPL2
Locus N/A Gene Type protein-coding
Synonyms ATG8; GATE-16; GATE16; GEF2
Full Name GABA(A) receptor-associated protein-like 2
Description GABA(A) receptor-associated protein-like 2
Chromosome 16q22.3-q24.1
Also Known As MAP1 light chain 3 related protein; ganglioside expression factor 2
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68550

ID Symbol Protein Species
GeneID:11345 GABARAPL2 NP_009216.1 Homo sapiens
GeneID:64670 Gabarapl2 NP_073197.1 Rattus norvegicus
GeneID:282531 GABARAPL2 NP_777100.1 Bos taurus
GeneID:403036 gabarapl2 NP_991286.1 Danio rerio
GeneID:454251 GABARAPL2 XP_511114.2 Pan troglodytes
GeneID:479646 GABARAPL2 XP_536778.2 Canis lupus familiaris
GeneID:770240 GABARAPL2 XP_001232689.1 Gallus gallus
GeneID:825794 ATG8B NP_849298.1 Arabidopsis thaliana
GeneID:828287 APG8A NP_001078424.1 Arabidopsis thaliana
GeneID:100042211 100042211 XP_001478273.1 Mus musculus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab72005 GABARAPL2 antibody (ab72005); Rabbit polyclonal to GABARAPL2
2 abcam ab62470 GABARAPL2 antibody (ab62470); Rabbit polyclonal to GABARAPL2
3 abcam ab62115 GABARAPL2 antibody (ab62115); Sheep polyclonal to GABARAPL2
4 abcam ab15858 GABARAPL2 antibody (ab15858); Chicken polyclonal to GABARAPL2
5 abgent AP1822c Autophagy GABARAPL2 (GATE16) Antibody (F77); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
6 abgent AP1822a Autophagy GABARAPL2 (GATE16) Antibody (P71); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
7 abgent AP1822b Autophagy GABARAPL2 (GATE16) Antibody (C-term); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)

Exon, Intron and UTRs

Exon, Intron and UTRs of GABARAPL2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of GABARAPL2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0000421 Component autophagic vacuole membrane
GO:0005829 Component cytosol
GO:0005794 Component Golgi apparatus
GO:0000139 Component Golgi membrane
GO:0005622 Component intracellular
GO:0005624 Component membrane fraction
GO:0051117 Function ATPase binding
GO:0048487 Function beta-tubulin binding
GO:0050811 Function GABA receptor binding
GO:0008017 Function microtubule binding
GO:0000149 Function SNARE binding
GO:0006914 Process autophagy
GO:0006891 Process intra-Golgi vesicle-mediated transport
GO:0032781 Process positive regulation of ATPase activity
GO:0015031 Process protein transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_007285  UCSC Browser NP_009216 P60520   Q6FG91  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000037243 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENST00000037243 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENST00000037243 MI0000457 hsa-miR-141* CAUCUUCCAGUACAGUGUUGGA
ENST00000037243 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENST00000037243 MI0000072 hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUAG
ENST00000037243 MI0001518 hsa-miR-18b UAAGGUGCAUCUAGUGCAGUUAG
ENST00000037243 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000037243 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000037243 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000037243 MI0000083 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000037243 MI0000750 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000037243 MI0000084 hsa-miR-26b UUCAAGUAAUUCAGGAUAGGU
ENST00000037243 MI0000781 hsa-miR-373* ACUCAAAAUGGGGGCGCUUUCC
ENST00000037243 MI0001445 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENST00000037243 MI0003183 hsa-miR-499-5p UUAAGACUUGCAGUGAUGUUU
ENST00000037243 MI0003184 hsa-miR-500* AUGCACCUGGGCAAGGAUUCUG
ENST00000037243 MI0003185 hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU
ENST00000037243 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENST00000037243 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000037243 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000037243 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000037243 MI0003169 hsa-miR-518e* CUCUAGAGGGAAGCGCUUUCUG
ENST00000037243 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000037243 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000037243 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000037243 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000037243 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENST00000037243 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENST00000037243 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENST00000037243 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000037243 MI0003643 hsa-miR-629 UGGGUUUACGUUGGGAGAACU
ENST00000037243 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENST00000037243 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENST00000037243 MI0003678 hsa-miR-656 AAUAUUAUACAGUCAACCUCU
ENST00000037243 MI0000263 hsa-miR-7-1* CAACAAAUCACAGUCUGCCAUA
ENST00000037243 MI0000264 hsa-miR-7-2* CAACAAAUCCCAGUCUACCUAA
ENST00000037243 MI0005537 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA
ENST00000037243 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENST00000037243 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENST00000037243 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENST00000037243 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000037243 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000037243 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000037243 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000037243 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENST00000037243 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENST00000037243 MI0004664 mmu-miR-694 CUGAAAAUGUUGCCUGAAG
ENST00000037243 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENST00000037243 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA
ENST00000037243 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid
  • 3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid results in increased expression of GABARAPL2 mRNA
16788091
Clofibric Acid
  • Clofibric Acid affects the expression of GABARAPL2 mRNA
17602206
Lindane
  • Lindane results in decreased expression of GABARAPL2 mRNA
17785943
nitrosobenzylmethylamine
  • nitrosobenzylmethylamine results in increased expression of GABARAPL2 mRNA
17616710
Tretinoin
  • Tretinoin results in increased expression of GABARAPL2 mRNA
16788091
Zinc
  • Zinc affects the expression of GABARAPL2 mRNA
16979875

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Acrodermatitis inferred via Zinc 17190629, 17202136, 16889938
Alzheimer Disease inferred via Zinc 17119284, 16325427, 16410023, 16580781
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16700911, 16606632, 16517595
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 12679006, 16823087, 15748426, 16788101, 16766008, 17506722, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17217047, 17107899, 16935935
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Esophageal Neoplasms inferred via nitrosobenzylmethylamine 16805852, 15150132, 15623463, 15547721, 16704527, 15547733, 15264214, 15878914, 16510608
Stomach Neoplasms inferred via nitrosobenzylmethylamine 17575124, 12958204
Agricultural Workers' Diseases inferred via Lindane 12661182
Breast Neoplasms inferred via Lindane 14688026
Neoplasms inferred via Lindane 16818664, 12807735
Prostatic Neoplasms inferred via Lindane 14688026, 12661182
Seizures inferred via Lindane 7539098
Liver Neoplasms inferred via Clofibric Acid 17602206

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
APG3L GABARAPL2 / APG3L Affinity Capture-MS Ewing RM (2007)
APG4B GABARAPL2 / APG4B Affinity Capture-MS Ewing RM (2007)
APG4B GABARAPL2 / APG4B Two-hybrid Stelzl U (2005)
BCL2L13 GABARAPL2 / BCL2L13 Two-hybrid Rual JF (2005)
EIF4G1 GABARAPL2 / EIF4G1 Affinity Capture-MS Ewing RM (2007)
HBG1 GABARAPL2 / HBG1 Affinity Capture-MS Ewing RM (2007)
IRGQ1 GABARAPL2 / IRGQ1 Affinity Capture-MS Ewing RM (2007)
LRPPRC GABARAPL2 / LRPPRC Affinity Capture-MS Ewing RM (2007)
MLX MLX / GABARAPL2 Two-hybrid Rual JF (2005)
NDP52 NDP52 / GABARAPL2 Two-hybrid Rual JF (2005)
NEK9 GABARAPL2 / NEK9 Affinity Capture-MS Ewing RM (2007)
RAP1A GABARAPL2 / RAP1A Biochemical Activity Kuiperij HB (2003)
RAP2A GABARAPL2 / RAP2A Biochemical Activity Kuiperij HB (2003)
SQSTM1 SQSTM1 / GABARAPL2 Two-hybrid Rual JF (2005)
TBC1D5 TBC1D5 / GABARAPL2 Two-hybrid Rual JF (2005)
TTBK1 TTBK1 / GABARAPL2 Affinity Capture-MS Ewing RM (2007)
UBE1DC1 GABARAPL2 / UBE1DC1 Two-hybrid Rual JF (2005)
ULK1 GABARAPL2 / ULK1 Reconstituted Complex Okazaki N (2000)
ULK1 ULK1 / GABARAPL2 Two-hybrid Okazaki N (2000)
VDAC1 GABARAPL2 / VDAC1 Affinity Capture-MS Ewing RM (2007)
VIL2 GABARAPL2 / VIL2 Affinity Capture-MS Ewing RM (2007)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sou YS, et al. (2008) "The Atg8 conjugation system is indispensable for proper development of autophagic isolation membranes in mice." Mol Biol Cell. 19(11):4762-4775. PMID:18768753
  2. [ + ] Shvets E, et al. (2008) "Autophagy-independent incorporation of GFP-LC3 into protein aggregates is dependent on its interaction with p62/SQSTM1." Autophagy. 4(8):1054-1056. PMID:18776740
  3. [ + ] Ewing RM, et al. (2007) "Large-scale mapping of human protein-protein interactions by mass spectrometry." Mol Syst Biol. 3():89. PMID:17353931
  4. [ + ] Mehrle A, et al. (2006) "The LIFEdb database in 2006." Nucleic Acids Res. 34(Database issue):D415-D418. PMID:16381901
  5. [ + ] Sou YS, et al. (2006) "Phosphatidylserine in addition to phosphatidylethanolamine is an in vitro target of the mammalian Atg8 modifiers, LC3, GABARAP, and GATE-16." J Biol Chem. 281(6):3017-3024. PMID:16303767
  6. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  7. [ + ] Rual JF, et al. (2005) "Towards a proteome-scale map of the human protein-protein interaction network." Nature. 437(7062):1173-1178. PMID:16189514
  8. [ + ] Kabeya Y, et al. (2004) "LC3, GABARAP and GATE16 localize to autophagosomal membrane depending on form-II formation." J Cell Sci. 117(Pt 13):2805-2812. PMID:15169837
  9. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  10. [ + ] Wiemann S, et al. (2004) "From ORFeome to biology: a functional genomics pipeline." Genome Res. 14(10B):2136-2144. PMID:15489336
  11. [ + ] Kuiperij HB, et al. (2003) "Characterisation of PDZ-GEFs, a family of guanine nucleotide exchange factors specific for Rap1 and Rap2." Biochim Biophys Acta. 1593(2-3):141-149. PMID:12581858
  12. [ + ] Scherz-Shouval R, et al. (2003) "The COOH terminus of GATE-16, an intra-Golgi transport modulator, is cleaved by the human cysteine protease HsApg4A." J Biol Chem. 278(16):14053-14058. PMID:12473658
  13. [ + ] Tanida I, et al. (2003) "GATE-16 and GABARAP are authentic modifiers mediated by Apg7 and Apg3." Biochem Biophys Res Commun. 300(3):637-644. PMID:12507496
  14. [ + ] Tanida I, et al. (2002) "Murine Apg12p has a substrate preference for murine Apg7p over three Apg8p homologs." Biochem Biophys Res Commun. 292(1):256-262. PMID:11890701
  15. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  16. [ + ] Xin Y, et al. (2001) "Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein." Genomics. 74(3):408-413. PMID:11414770
  17. [ + ] Sagiv Y, et al. (2000) "GATE-16, a membrane transport modulator, interacts with NSF and the Golgi v-SNARE GOS-28." EMBO J. 19(7):1494-1504. PMID:10747018
  18. [ + ] Simpson JC, et al. (2000) "Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing." EMBO Rep. 1(3):287-292. PMID:11256614
  19. [ + ] Hartley JL, et al. (2000) "DNA cloning using in vitro site-specific recombination." Genome Res. 10(11):1788-1795. PMID:11076863
  20. [ + ] Okazaki N, et al. (2000) "Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation." Brain Res Mol Brain Res. 85(1-2):1-12. PMID:11146101