GABARAP | GeneID:11337 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 11337 Official Symbol GABARAP
Locus N/A Gene Type protein-coding
Synonyms FLJ25768; MGC120154; MGC120155; MM46
Full Name GABA(A) receptor-associated protein
Description GABA(A) receptor-associated protein
Chromosome 17p13.1
Also Known As
Summary Gamma-aminobutyric acid A receptors [GABA(A) receptors] are ligand-gated chloride channels that mediate inhibitory neurotransmission. This gene encodes GABA(A) receptor-associated protein, which is highly positively charged in its N-terminus and shares sequence similarity with light chain-3 of microtubule-associated proteins 1A and 1B. This protein clusters neurotransmitter receptors by mediating interaction with the cytoskeleton. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10508

ID Symbol Protein Species
GeneID:11337 GABARAP NP_009209.1 Homo sapiens
GeneID:32001 Atg8a NP_727447.1 Drosophila melanogaster
GeneID:56486 Gabarap NP_062723.1 Mus musculus
GeneID:58974 Gabarap NP_742033.1 Rattus norvegicus
GeneID:174050 lgg-1 NP_495277.1 Caenorhabditis elegans
GeneID:327715 GABARAP NP_001029220.1 Bos taurus
GeneID:479479 GABARAP XP_536616.2 Canis lupus familiaris
GeneID:748888 GABARAP XP_001169709.1 Pan troglodytes
GeneID:793200 LOC793200 XP_001332909.2 Danio rerio
GeneID:815112 ATG8D NP_178631.1 Arabidopsis thaliana
GeneID:852200 ATG8 NP_009475.1 Saccharomyces cerevisiae
GeneID:1273277 AgaP_AGAP002685 XP_312238.1 Anopheles gambiae
GeneID:2541386 atg8 NP_596531.1 Schizosaccharomyces pombe
GeneID:2674322 MGG_01062 XP_368182.1 Magnaporthe grisea
GeneID:2710011 NCU01545.1 XP_327984.1 Neurospora crassa
GeneID:2894517 KLLA0E20669g XP_454881.1 Kluyveromyces lactis
GeneID:4621467 AGOS_AER396W NP_985251.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab1133 GABARAP antibody (ab1133); Rabbit polyclonal to GABARAP
2 abcam ab1398 GABARAP antibody (ab1398); Rabbit polyclonal to GABARAP
3 abcam ab62471 GABARAP antibody (ab62471); Rabbit polyclonal to GABARAP
4 abcam ab62114 GABARAP antibody (ab62114); Sheep polyclonal to GABARAP
5 abgent AP1821a Autophagy GABARAP Antibody (N-term); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
6 abgent AP1821b Autophagy GABARAP Antibody (Y95); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
7 acris AP00768PU-N GABARAP; antibody Ab
8 scbt GABARAP GABARAP Antibody / GABARAP Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of GABARAP Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of GABARAP Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0015629 Component actin cytoskeleton
GO:0000421 Component autophagic vacuole membrane
GO:0005737 Component cytoplasm
GO:0005794 Component Golgi apparatus
GO:0000139 Component Golgi membrane
GO:0005764 Component lysosome
GO:0005874 Component microtubule
GO:0005875 Component microtubule associated complex
GO:0005886 Component plasma membrane
GO:0005790 Component smooth endoplasmic reticulum
GO:0048487 Function beta-tubulin binding
GO:0050811 Function GABA receptor binding
GO:0008017 Function microtubule binding
GO:0005515 Function protein binding
GO:0000226 Process microtubule cytoskeleton organization
GO:0006605 Process protein targeting
GO:0015031 Process protein transport
GO:0007268 Process synaptic transmission

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_007278  UCSC Browser NP_009209 Q6IAW1   O95166  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000302386 MI0004997 gga-miR-456 CAGGCUGGUUAGAUGGUUGUCA
ENST00000302386 MI0000064 hsa-let-7c* UAGAGUUACACCCUGGGAGUUA
ENST00000302386 MI0000442 hsa-miR-122* AACGCCAUUAUCACACUAAAUA
ENST00000302386 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000302386 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000302386 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENST00000302386 MI0000809 hsa-miR-151-3p CUAGACUGAAGCUCCUUGAGG
ENST00000302386 MI0000809 hsa-miR-151-5p UCGAGGAGCUCACAGUCUAGU
ENST00000302386 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENST00000302386 MI0000465 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG
ENST00000302386 MI0000234 hsa-miR-192* CUGCCAAUUCCAUAGGUCACAG
ENST00000302386 MI0000290 hsa-miR-214 ACAGCAGGCACAGACAGGCAGU
ENST00000302386 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENST00000302386 MI0000742 hsa-miR-34b CAAUCACUAACUCCACUGCCAU
ENST00000302386 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENST00000302386 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000302386 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENST00000302386 MI0003513 hsa-miR-455-5p UAUGUGCCUUUGGACUACAUCG
ENST00000302386 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENST00000302386 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000302386 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENST00000302386 MI0003599 hsa-miR-589* UCAGAACAAAUGCCGGUUCCCAGA
ENST00000302386 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000302386 MI0003632 hsa-miR-618 AAACUCUACUUGUCCUUCUGAGU
ENST00000302386 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENST00000302386 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENST00000302386 MI0005116 hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG
ENST00000302386 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENST00000302386 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENST00000302386 MI0005537 hsa-miR-888* GACUGACACCUCUUUGGGUGAA
ENST00000302386 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENST00000302386 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENST00000302386 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENST00000302386 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000302386 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENST00000302386 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENST00000302386 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENST00000302386 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENST00000302386 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENST00000302386 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENST00000302386 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENST00000302386 MI0005206 mmu-miR-742 GAAAGCCACCAUGCUGGGUAAA
ENST00000302386 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA
ENST00000302386 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Ascorbic Acid
  • Ascorbic Acid results in increased expression of GABARAP mRNA
15305145
dicyclanil
  • dicyclanil results in increased expression of GABARAP mRNA
15664270
Hydralazine
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of GABARAP mRNA
17183730
Raloxifene
  • Raloxifene affects the expression of GABARAP mRNA
16079270
Valproic Acid
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of GABARAP mRNA
17183730

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Dystonia inferred via Valproic Acid 1851702
Fatty Liver inferred via Valproic Acid 14986274
Leukemia, Myeloid, Acute inferred via Valproic Acid 16294345
Migraine Disorders inferred via Valproic Acid 18765137, 18803445
Pseudolymphoma inferred via Valproic Acid 12752131
Seizures inferred via Valproic Acid 11738929
Unverricht-Lundborg Syndrome inferred via Valproic Acid 3119515
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 15758505, 17595753, 16837676, 17440819, 15775269, 16912660, 17893378, 17952589, 17261762, 15572757, 17049068
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 17451421, 15920148
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 17893378, 15579764, 17823083
Prostatic Neoplasms inferred via Raloxifene 16220300, 16536755, 15731164
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Hypertension, Pregnancy-Induced inferred via Hydralazine 16612254
Breast Neoplasms inferred via Ascorbic Acid 16443354
Common Cold inferred via Ascorbic Acid 17323712
Diabetes Mellitus, Type 2 inferred via Ascorbic Acid 16506275
Heart Defects, Congenital inferred via Ascorbic Acid 16080930
Hernia, Diaphragmatic inferred via Ascorbic Acid 16863852, 16490937
Lung Diseases inferred via Ascorbic Acid 16863852
Lung Neoplasms inferred via Ascorbic Acid 16401635
Obesity inferred via Ascorbic Acid 17217161
Pulmonary Eosinophilia inferred via Ascorbic Acid 14606601
Retinitis Pigmentosa inferred via Ascorbic Acid 16849425
Stroke inferred via Ascorbic Acid 16517955

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
APG4B GABARAP / APG4B Two-hybrid Stelzl U (2005)
GABARAP GABARAP / GABARAP Co-crystal Structure Coyle JE (2002)
GABARAP GABARAP / GABARAP Reconstituted Complex Nymann-Andersen J (2002)
GABRG2 GABRG2 / GABARAP Affinity Capture-Western Wang H (1999)
GABRG2 GABARAP / GABRG2 Protein-peptide Coyle JE (2002)
GABRG2 GABRG2 / GABARAP Reconstituted Complex Wang H (1999)
GABRG2 GABRG2 / GABARAP Two-hybrid Nymann-Andersen J (2002)
GABRG2 GABRG2 / GABARAP Two-hybrid Wang H (1999)
HDAC5 HDAC5 / GABARAP Two-hybrid Stelzl U (2005)
TFRC TFRC / GABARAP Affinity Capture-Western Green F (2002)
TFRC GABARAP / TFRC Reconstituted Complex Green F (2002)
TFRC TFRC / GABARAP Two-hybrid Green F (2002)
TUBB3 TUBB3 / GABARAP Two-hybrid Stelzl U (2005)
ULK1 ULK1 / GABARAP Affinity Capture-MS Ewing RM (2007)
ULK1 GABARAP / ULK1 Reconstituted Complex Okazaki N (2000)
ULK1 ULK1 / GABARAP Two-hybrid Okazaki N (2000)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Thielmann Y, et al. (2009) "Structural framework of the GABARAP-calreticulin interface--implications for substrate binding to endoplasmic reticulum chaperones." FEBS J. 276(4):1140-1152. PMID:19154346
  2. [ + ] Weiergraber OH, et al. (2008) "Ligand binding mode of GABAA receptor-associated protein." J Mol Biol. 381(5):1320-1331. PMID:18638487
  3. [ + ] Ewing RM, et al. (2007) "Large-scale mapping of human protein-protein interactions by mass spectrometry." Mol Syst Biol. 3():89. PMID:17353931
  4. [ + ] Lou XY, et al. (2007) "Fine mapping of a linkage region on chromosome 17p13 reveals that GABARAP and DLG4 are associated with vulnerability to nicotine dependence in European-Americans." Hum Mol Genet. 16(2):142-153. PMID:17164261
  5. [ + ] Kawaguchi SY, et al. (2007) "Sustained structural change of GABA(A) receptor-associated protein underlies long-term potentiation at inhibitory synapses on a cerebellar Purkinje neuron." J Neurosci. 27(25):6788-6799. PMID:17581966
  6. [ + ] Sou YS, et al. (2006) "Phosphatidylserine in addition to phosphatidylethanolamine is an in vitro target of the mammalian Atg8 modifiers, LC3, GABARAP, and GATE-16." J Biol Chem. 281(6):3017-3024. PMID:16303767
  7. [ + ] Tanida I, et al. (2006) "Lysosomal turnover of GABARAP-phospholipid conjugate is activated during differentiation of C2C12 cells to myotubes without inactivation of the mTor kinase-signaling pathway." Autophagy. 2(4):264-271. PMID:16874098
  8. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  9. [ + ] Lee JH, et al. (2005) "GABAA receptor-associated protein (GABARAP) induces apoptosis by interacting with DEAD (Asp-Glu-Ala-Asp/His) box polypeptide 47 (DDX 47)." Biotechnol Lett. 27(9):623-628. PMID:15977068
  10. [ + ] Boileau AJ, et al. (2005) "Tandem subunits effectively constrain GABAA receptor stoichiometry and recapitulate receptor kinetics but are insensitive to GABAA receptor-associated protein." J Neurosci. 25(49):11219-11230. PMID:16339017
  11. [ + ] Klebig C, et al. (2005) "Characterization of {gamma}-aminobutyric acid type A receptor-associated protein, a novel tumor suppressor, showing reduced expression in breast cancer." Cancer Res. 65(2):394-400. PMID:15695379
  12. [ + ] Kabeya Y, et al. (2004) "LC3, GABARAP and GATE16 localize to autophagosomal membrane depending on form-II formation." J Cell Sci. 117(Pt 13):2805-2812. PMID:15169837
  13. [ + ] Nemos C, et al. (2003) "Expression of gec1/GABARAPL1 versus GABARAP mRNAs in human: predominance of gec1/GABARAPL1 in the central nervous system." Brain Res Mol Brain Res. 119(2):216-219. PMID:14625090
  14. [ + ] Tanida I, et al. (2003) "GATE-16 and GABARAP are authentic modifiers mediated by Apg7 and Apg3." Biochem Biophys Res Commun. 300(3):637-644. PMID:12507496
  15. [ + ] Nymann-Andersen J, et al. (2002) "Subunit specificity and interaction domain between GABA(A) receptor-associated protein (GABARAP) and GABA(A) receptors." J Neurochem. 80(5):815-823. PMID:11948245
  16. [ + ] Knight D, et al. (2002) "The X-ray crystal structure and putative ligand-derived peptide binding properties of gamma-aminobutyric acid receptor type A receptor-associated protein." J Biol Chem. 277(7):5556-5561. PMID:11729197
  17. [ + ] Coyle JE, et al. (2002) "Structure of GABARAP in two conformations: implications for GABA(A) receptor localization and tubulin binding." Neuron. 33(1):63-74. PMID:11779480
  18. [ + ] Tanida I, et al. (2002) "Human Apg3p/Aut1p homologue is an authentic E2 enzyme for multiple substrates, GATE-16, GABARAP, and MAP-LC3, and facilitates the conjugation of hApg12p to hApg5p." J Biol Chem. 277(16):13739-13744. PMID:11825910
  19. [ + ] Stangler T, et al. (2002) "Solution structure of human GABA(A) receptor-associated protein GABARAP: implications for biolgoical funcrion and its regulation." J Biol Chem. 277(16):13363-13366. PMID:11875056
  20. [ + ] Kouno T, et al. (2002) "1H, 13C and '5N resonance assignments of GABARAP, GABAA receptor associated protein." J Biomol NMR. 22(1):97-98. PMID:11885988
  21. [ + ] Tanida I, et al. (2002) "Murine Apg12p has a substrate preference for murine Apg7p over three Apg8p homologs." Biochem Biophys Res Commun. 292(1):256-262. PMID:11890701
  22. [ + ] Kanematsu T, et al. (2002) "[The analysis of protein-protein interaction with special reference to PRIP-1]" Nippon Yakurigaku Zasshi. 119(4):241-246. PMID:11979730
  23. [ + ] Green F, et al. (2002) "Association of human transferrin receptor with GABARAP." FEBS Lett. 518(1-3):101-106. PMID:11997026
  24. [ + ] Nymann-Andersen J, et al. (2002) "Biochemical identification of the binding domain in the GABA(A) receptor-associated protein (GABARAP) mediating dimer formation." Neuropharmacology. 43(4):476-481. PMID:12367594
  25. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  26. [ + ] Stangler T, et al. (2001) "Sequence-specific 1H, 13C and 15N resonance assignments of human GABA receptor associated protein." J Biomol NMR. 21(2):183-184. PMID:11727985
  27. [ + ] Kittler JT, et al. (2001) "The subcellular distribution of GABARAP and its ability to interact with NSF suggest a role for this protein in the intracellular transport of GABA(A) receptors." Mol Cell Neurosci. 18(1):13-25. PMID:11461150
  28. [ + ] Xin Y, et al. (2001) "Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein." Genomics. 74(3):408-413. PMID:11414770
  29. [ + ] Harris R, et al. (2001) "Backbone 1H, 13C, and 15N resonance assignments for a 14 kD protein, GABA(A) receptor associated protein (GABARAP)." J Biomol NMR. 21(2):185-186. PMID:11727986
  30. [ + ] Tanida I, et al. (2001) "The human homolog of Saccharomyces cerevisiae Apg7p is a Protein-activating enzyme for multiple substrates including human Apg12p, GATE-16, GABARAP, and MAP-LC3." J Biol Chem. 276(3):1701-1706. PMID:11096062
  31. [ + ] Kneussel M, et al. (2000) "The gamma-aminobutyric acid type A receptor (GABAAR)-associated protein GABARAP interacts with gephyrin but is not involved in receptor anchoring at the synapse." Proc Natl Acad Sci U S A. 97(15):8594-8599. PMID:10900017
  32. [ + ] Wang H, et al. (2000) "Binding of the GABA(A) receptor-associated protein (GABARAP) to microtubules and microfilaments suggests involvement of the cytoskeleton in GABARAPGABA(A) receptor interaction." J Neurochem. 75(2):644-655. PMID:10899939
  33. [ + ] Paz Y, et al. (2000) "Structure of GATE-16, membrane transport modulator and mammalian ortholog of autophagocytosis factor Aut7p." J Biol Chem. 275(33):25445-25450. PMID:10856287
  34. [ + ] Okazaki N, et al. (2000) "Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation." Brain Res Mol Brain Res. 85(1-2):1-12. PMID:11146101
  35. [ + ] Zhang QH, et al. (2000) "Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells." Genome Res. 10(10):1546-1560. PMID:11042152
  36. [ + ] Chen L, et al. (2000) "The gamma-aminobutyric acid type A (GABAA) receptor-associated protein (GABARAP) promotes GABAA receptor clustering and modulates the channel kinetics." Proc Natl Acad Sci U S A. 97(21):11557-11562. PMID:10984509
  37. [ + ] Hu RM, et al. (2000) "Gene expression profiling in the human hypothalamus-pituitary-adrenal axis and full-length cDNA cloning." Proc Natl Acad Sci U S A. 97(17):9543-9548. PMID:10931946
  38. [ + ] Wang H, et al. (1999) "GABA(A)-receptor-associated protein links GABA(A) receptors and the cytoskeleton." Nature. 397(6714):69-72. PMID:9892355