Abi1 | GeneID:11308 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 11308 Official Symbol Abi1
Locus N/A Gene Type protein-coding
Synonyms E3B1; MGC6064; NAP1; Ssh3bp1
Full Name abl-interactor 1
Description abl-interactor 1
Chromosome 2 A3|2 15.0 cM
Also Known As abelson interactor 1; ablphilin-1; eps8 binding protein; spectrin SH3 domain binding protein 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 38053

ID Symbol Protein Species
GeneID:10006 ABI1 NP_005461.2 Homo sapiens
GeneID:11308 Abi1 NP_001070658.1 Mus musculus
GeneID:79249 Abi1 NP_077373.1 Rattus norvegicus
GeneID:420489 RCJMB04_25c5 XP_001233769.1 Gallus gallus
GeneID:450363 ABI1 XP_001159512.1 Pan troglodytes
GeneID:607247 ABI1 XP_849209.1 Canis lupus familiaris
GeneID:767738 zgc:153534 NP_001070175.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab11222 SSH3BP1 antibody [4E2] (ab11222); Mouse monoclonal [4E2] to SSH3BP1
2 abcam ab65828 SSH3BP1 antibody - Carboxyterminal end (ab65828); Rabbit polyclonal to SSH3BP1 - Carboxyterminal end
3 abcam ab62660 SSH3BP1 antibody (ab62660); Rabbit polyclonal to SSH3BP1
4 abcam ab55901 SSH3BP1 antibody - Carboxyterminal end (ab55901); Rabbit polyclonal to SSH3BP1 - Carboxyterminal end
5 abcam ab55834 SSH3BP1 (phospho Y435) antibody (ab55834); Rabbit polyclonal to SSH3BP1 (phospho Y435)
6 sigma A5106 Anti-ABI1 antibody produced in rabbit ;
7 sigma A5231 Anti-Abi1 (C-terminal) antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030054 Component cell junction
GO:0031252 Component cell leading edge
GO:0042995 Component cell projection
GO:0005737 Component cytoplasm
GO:0005856 Component cytoskeleton
GO:0005622 Component intracellular
GO:0030027 Component lamellipodium
GO:0005634 Component nucleus
GO:0045202 Component synapse
GO:0019717 Component synaptosome
GO:0005515 Function protein binding
GO:0030296 Function protein tyrosine kinase activator activity
GO:0009987 Process cellular process
GO:0018108 Process peptidyl-tyrosine phosphorylation
GO:0001756 Process somitogenesis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001077190  UCSC Browser NP_001070658
2 NM_001077192  UCSC Browser NP_001070660 Q3TPY5   Q8CBW3  
3 NM_001077193  UCSC Browser NP_001070661
4 NM_007380  UCSC Browser NP_031406
5 NM_145994  UCSC Browser NP_666106

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000091394 MI0003197 hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC
ENSMUST00000091394 MI0003561 hsa-miR-555 AGGGUAAGCUGAACCUCUGAU
ENSMUST00000091394 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSMUST00000091394 MI0003644 hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU
ENSMUST00000091394 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSMUST00000091394 MI0000562 mmu-let-7f* CUAUACAAUCUAUUGCCUUCCC
ENSMUST00000091394 MI0000148 mmu-miR-101a* UCAGUUAUCACAGUGCUGAUGC
ENSMUST00000091394 MI0000163 mmu-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENSMUST00000091394 MI0000166 mmu-miR-141 UAACACUGUCUGGUAAAGAUGG
ENSMUST00000091394 MI0000554 mmu-miR-200a UAACACUGUCUGGUAACGAUGU
ENSMUST00000091394 MI0000243 mmu-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENSMUST00000091394 MI0000694 mmu-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENSMUST00000091394 MI0000731 mmu-miR-217 UACUGCAUCAGGAACUGACUGGA
ENSMUST00000091394 MI0000619 mmu-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENSMUST00000091394 MI0001161 mmu-miR-410 AAUAUAACACAGAUGGCCUGU
ENSMUST00000091394 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENSMUST00000091394 MI0003484 mmu-miR-483 AAGACGGGAGAAGAGAAGGGAG
ENSMUST00000091394 MI0005516 mmu-miR-509-3p UGAUUGACAUUUCUGUAAUGG
ENSMUST00000091394 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENSMUST00000091394 MI0004203 mmu-miR-770-5p AGCACCACGUGUCUGGGCCACG
ENSMUST00000091394 MI0004249 mmu-miR-802 UCAGUAACAAAGAUUCAUCCUU
ENSMUST00000091394 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENSMUST00000091394 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sawallisch C, et al. (2009) "The insulin receptor substrate of 53 kDa (IRSp53) limits hippocampal synaptic plasticity." J Biol Chem. 284(14):9225-9236. PMID:19208628
  2. [ + ] Abou-Kheir W, et al. (2008) "Membrane targeting of WAVE2 is not sufficient for WAVE2-dependent actin polymerization: a role for IRSp53 in mediating the interaction between Rac and WAVE2." J Cell Sci. 121(Pt 3):379-390. PMID:18198193
  3. [ + ] Eto K, et al. (2007) "The WAVE2/Abi1 complex differentially regulates megakaryocyte development and spreading: implications for platelet biogenesis and spreading machinery." Blood. 110(10):3637-3647. PMID:17664349
  4. [ + ] Munton RP, et al. (2007) "Qualitative and quantitative analyses of protein phosphorylation in naive and stimulated mouse synaptosomal preparations." Mol Cell Proteomics. 6(2):283-293. PMID:17114649
  5. [ + ] Zipfel PA, et al. (2006) "Role for the Abi/wave protein complex in T cell receptor-mediated proliferation and cytoskeletal remodeling." Curr Biol. 16(1):35-46. PMID:16401422
  6. [ + ] Rakeman AS, et al. (2006) "Axis specification and morphogenesis in the mouse embryo require Nap1, a regulator of WAVE-mediated actin branching." Development. 133(16):3075-3083. PMID:16831833
  7. [ + ] Hirao N, et al. (2006) "NESH (Abi-3) is present in the Abi/WAVE complex but does not promote c-Abl-mediated phosphorylation." FEBS Lett. 580(27):6464-6470. PMID:17101133
  8. [ + ] Campa F, et al. (2006) "A new interaction between Abi-1 and betaPIX involved in PDGF-activated actin cytoskeleton reorganisation." Cell Res. 16(9):759-770. PMID:16940963
  9. [ + ] Stuart JR, et al. (2006) "c-Abl interacts with the WAVE2 signaling complex to induce membrane ruffling and cell spreading." J Biol Chem. 281(42):31290-31297. PMID:16899465
  10. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  11. [ + ] Kheir WA, et al. (2005) "A WAVE2-Abi1 complex mediates CSF-1-induced F-actin-rich membrane protrusions and migration in macrophages." J Cell Sci. 118(Pt 22):5369-5379. PMID:16280551
  12. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  13. [ + ] Garcia-Garcia MJ, et al. (2005) "Analysis of mouse embryonic patterning and morphogenesis by forward genetics." Proc Natl Acad Sci U S A. 102(17):5913-5919. PMID:15755804
  14. [ + ] Papin J, et al. (2004) "Bioinformatics and cellular signaling." Curr Opin Biotechnol. 15(1):78-81. PMID:15102471
  15. [ + ] Steffen A, et al. (2004) "Sra-1 and Nap1 link Rac to actin assembly driving lamellipodia formation." EMBO J. 23(4):749-759. PMID:14765121
  16. [ + ] Echarri A, et al. (2004) "Abl interactor 1 (Abi-1) wave-binding and SNARE domains regulate its nucleocytoplasmic shuttling, lamellipodium localization, and wave-1 levels." Mol Cell Biol. 24(11):4979-4993. PMID:15143189
  17. [ + ] Blackshaw S, et al. (2004) "Genomic analysis of mouse retinal development." PLoS Biol. 2(9):E247. PMID:15226823
  18. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  19. [ + ] Grove M, et al. (2004) "ABI2-deficient mice exhibit defective cell migration, aberrant dendritic spine morphogenesis, and deficits in learning and memory." Mol Cell Biol. 24(24):10905-10922. PMID:15572692
  20. [ + ] Watahiki A, et al. (2004) "Libraries enriched for alternatively spliced exons reveal splicing patterns in melanocytes and melanomas." Nat Methods. 1(3):233-239. PMID:15782199
  21. [ + ] Tani K, et al. (2003) "Abl interactor 1 promotes tyrosine 296 phosphorylation of mammalian enabled (Mena) by c-Abl kinase." J Biol Chem. 278(24):21685-21692. PMID:12672821
  22. [ + ] Innocenti M, et al. (2003) "Phosphoinositide 3-kinase activates Rac by entering in a complex with Eps8, Abi1, and Sos-1." J Cell Biol. 160(1):17-23. PMID:12515821
  23. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  24. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  25. [ + ] Stradal T, et al. (2001) "The Abl interactor proteins localize to sites of actin polymerization at the tips of lamellipodia and filopodia." Curr Biol. 11(11):891-895. PMID:11516653
  26. [ + ] Ikeguchi A, et al. (2001) "Inhibition of v-Abl transformation in 3T3 cells overexpressing different forms of the Abelson interactor protein Abi-1." Oncogene. 20(36):4926-4934. PMID:11526477
  27. [ + ] Shibuya N, et al. (2001) "t(10;11)-acute leukemias with MLL-AF10 and MLL-ABI1 chimeric transcripts: specific expression patterns of ABI1 gene in leukemia and solid tumor cell lines." Genes Chromosomes Cancer. 32(1):1-10. PMID:11477655
  28. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  29. [ + ] Courtney KD, et al. (2000) "Localization and phosphorylation of Abl-interactor proteins, Abi-1 and Abi-2, in the developing nervous system." Mol Cell Neurosci. 16(3):244-257. PMID:10995551
  30. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  31. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  32. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  33. [ + ] Scita G, et al. (1999) "EPS8 and E3B1 transduce signals from Ras to Rac." Nature. 401(6750):290-293. PMID:10499589
  34. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  35. [ + ] Xiong JW, et al. (1999) "Vezf1: A Zn finger transcription factor restricted to endothelial cells and their precursors." Dev Biol. 206(2):123-141. PMID:9986727
  36. [ + ] Zechner U, et al. (1998) "Characterization of the mouse Src homology 3 domain gene Sh3d2c on Chr 7 demonstrates coexpression with huntingtin in the brain and identifies the processed pseudogene Sh3d2c-ps1 on Chr 2." Genomics. 54(3):505-510. PMID:9878254
  37. [ + ] Biesova Z, et al. (1997) "Isolation and characterization of e3B1, an eps8 binding protein that regulates cell growth." Oncogene. 14(2):233-241. PMID:9010225
  38. [ + ] Shi Y, et al. (1995) "Abl-interactor-1, a novel SH3 protein binding to the carboxy-terminal portion of the Abl protein, suppresses v-abl transforming activity." Genes Dev. 9(21):2583-2597. PMID:7590237