Abi1 | GeneID:11308 | Mus musculus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 11308 | Official Symbol | Abi1 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | E3B1; MGC6064; NAP1; Ssh3bp1 | ||
| Full Name | abl-interactor 1 | ||
| Description | abl-interactor 1 | ||
| Chromosome | 2 A3|2 15.0 cM | ||
| Also Known As | abelson interactor 1; ablphilin-1; eps8 binding protein; spectrin SH3 domain binding protein 1 | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 38053
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:10006 | ABI1 | NP_005461.2 | Homo sapiens |
| GeneID:11308 | Abi1 | NP_001070658.1 | Mus musculus |
| GeneID:79249 | Abi1 | NP_077373.1 | Rattus norvegicus |
| GeneID:420489 | RCJMB04_25c5 | XP_001233769.1 | Gallus gallus |
| GeneID:450363 | ABI1 | XP_001159512.1 | Pan troglodytes |
| GeneID:607247 | ABI1 | XP_849209.1 | Canis lupus familiaris |
| GeneID:767738 | zgc:153534 | NP_001070175.1 | Danio rerio |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab11222 | SSH3BP1 antibody [4E2] (ab11222); Mouse monoclonal [4E2] to SSH3BP1 |
| 2 | abcam | ab65828 | SSH3BP1 antibody - Carboxyterminal end (ab65828); Rabbit polyclonal to SSH3BP1 - Carboxyterminal end |
| 3 | abcam | ab62660 | SSH3BP1 antibody (ab62660); Rabbit polyclonal to SSH3BP1 |
| 4 | abcam | ab55901 | SSH3BP1 antibody - Carboxyterminal end (ab55901); Rabbit polyclonal to SSH3BP1 - Carboxyterminal end |
| 5 | abcam | ab55834 | SSH3BP1 (phospho Y435) antibody (ab55834); Rabbit polyclonal to SSH3BP1 (phospho Y435) |
| 6 | sigma | A5106 | Anti-ABI1 antibody produced in rabbit ; |
| 7 | sigma | A5231 | Anti-Abi1 (C-terminal) antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0030054 | Component | cell junction |
| GO:0031252 | Component | cell leading edge |
| GO:0042995 | Component | cell projection |
| GO:0005737 | Component | cytoplasm |
| GO:0005856 | Component | cytoskeleton |
| GO:0005622 | Component | intracellular |
| GO:0030027 | Component | lamellipodium |
| GO:0005634 | Component | nucleus |
| GO:0045202 | Component | synapse |
| GO:0019717 | Component | synaptosome |
| GO:0005515 | Function | protein binding |
| GO:0030296 | Function | protein tyrosine kinase activator activity |
| GO:0009987 | Process | cellular process |
| GO:0018108 | Process | peptidyl-tyrosine phosphorylation |
| GO:0001756 | Process | somitogenesis |
RefSeq Isoforms
[
] RefSeq Annotation and UniProt Database
| No. | RefSeq RNA | RefSeq Protein | UniProt Equivalent |
|---|---|---|---|
| 1 | NM_001077190 UCSC Browser | NP_001070658 | |
| 2 | NM_001077192 UCSC Browser | NP_001070660 | Q3TPY5 Q8CBW3 |
| 3 | NM_001077193 UCSC Browser | NP_001070661 | |
| 4 | NM_007380 UCSC Browser | NP_031406 | |
| 5 | NM_145994 UCSC Browser | NP_666106 | |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSMUST00000091394 | MI0003197 | hsa-miR-510 | UACUCAGGAGAGUGGCAAUCAC |
| ENSMUST00000091394 | MI0003561 | hsa-miR-555 | AGGGUAAGCUGAACCUCUGAU |
| ENSMUST00000091394 | MI0003580 | hsa-miR-573 | CUGAAGUGAUGUGUAACUGAUCAG |
| ENSMUST00000091394 | MI0003644 | hsa-miR-630 | AGUAUUCUGUACCAGGGAAGGU |
| ENSMUST00000091394 | MI0003677 | hsa-miR-655 | AUAAUACAUGGUUAACCUCUUU |
| ENSMUST00000091394 | MI0000562 | mmu-let-7f* | CUAUACAAUCUAUUGCCUUCCC |
| ENSMUST00000091394 | MI0000148 | mmu-miR-101a* | UCAGUUAUCACAGUGCUGAUGC |
| ENSMUST00000091394 | MI0000163 | mmu-miR-137 | UUAUUGCUUAAGAAUACGCGUAG |
| ENSMUST00000091394 | MI0000166 | mmu-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| ENSMUST00000091394 | MI0000554 | mmu-miR-200a | UAACACUGUCUGGUAACGAUGU |
| ENSMUST00000091394 | MI0000243 | mmu-miR-200b | UAAUACUGCCUGGUAAUGAUGA |
| ENSMUST00000091394 | MI0000694 | mmu-miR-200c | UAAUACUGCCGGGUAAUGAUGGA |
| ENSMUST00000091394 | MI0000731 | mmu-miR-217 | UACUGCAUCAGGAACUGACUGGA |
| ENSMUST00000091394 | MI0000619 | mmu-miR-338-5p | AACAAUAUCCUGGUGCUGAGUG |
| ENSMUST00000091394 | MI0001161 | mmu-miR-410 | AAUAUAACACAGAUGGCCUGU |
| ENSMUST00000091394 | MI0002403 | mmu-miR-468 | UAUGACUGAUGUGCGUGUGUCUG |
| ENSMUST00000091394 | MI0003484 | mmu-miR-483 | AAGACGGGAGAAGAGAAGGGAG |
| ENSMUST00000091394 | MI0005516 | mmu-miR-509-3p | UGAUUGACAUUUCUGUAAUGG |
| ENSMUST00000091394 | MI0004649 | mmu-miR-685 | UCAAUGGCUGAGGUGAGGCAC |
| ENSMUST00000091394 | MI0004203 | mmu-miR-770-5p | AGCACCACGUGUCUGGGCCACG |
| ENSMUST00000091394 | MI0004249 | mmu-miR-802 | UCAGUAACAAAGAUUCAUCCUU |
| ENSMUST00000091394 | MI0003722 | rno-miR-664 | UAUUCAUUUACUCCCCAGCCUA |
| ENSMUST00000091394 | MI0003723 | rno-miR-664 | UAUUCAUUUACUCCCCAGCCUA |
Transcript Sequences
[
] Transcript Accession Number Cloud [ GenBank ]
AF420251 AK034476 AK151026 AK151363 AK152046 AK152061 AK152184 AK153130 AK164040 AK165924 AK167328 AK167568 AK167744 AK181529 AK184875 AK190191 AK191075 AK199630 AK201770 AK215001 AV294883 AY033645 BB128743 BC004657 BC079642 BE628445 BY278454 NM_001077190 NM_001077192 NM_001077193 NM_007380 NM_145994 U17698
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Sawallisch C, et al. (2009) "The insulin receptor substrate of 53 kDa (IRSp53) limits hippocampal synaptic plasticity." J Biol Chem. 284(14):9225-9236. PMID:19208628 - [
] Abou-Kheir W, et al. (2008) "Membrane targeting of WAVE2 is not sufficient for WAVE2-dependent actin polymerization: a role for IRSp53 in mediating the interaction between Rac and WAVE2." J Cell Sci. 121(Pt 3):379-390. PMID:18198193 - [
] Eto K, et al. (2007) "The WAVE2/Abi1 complex differentially regulates megakaryocyte development and spreading: implications for platelet biogenesis and spreading machinery." Blood. 110(10):3637-3647. PMID:17664349 - [
] Munton RP, et al. (2007) "Qualitative and quantitative analyses of protein phosphorylation in naive and stimulated mouse synaptosomal preparations." Mol Cell Proteomics. 6(2):283-293. PMID:17114649 - [
] Zipfel PA, et al. (2006) "Role for the Abi/wave protein complex in T cell receptor-mediated proliferation and cytoskeletal remodeling." Curr Biol. 16(1):35-46. PMID:16401422 - [
] Rakeman AS, et al. (2006) "Axis specification and morphogenesis in the mouse embryo require Nap1, a regulator of WAVE-mediated actin branching." Development. 133(16):3075-3083. PMID:16831833 - [
] Hirao N, et al. (2006) "NESH (Abi-3) is present in the Abi/WAVE complex but does not promote c-Abl-mediated phosphorylation." FEBS Lett. 580(27):6464-6470. PMID:17101133 - [
] Campa F, et al. (2006) "A new interaction between Abi-1 and betaPIX involved in PDGF-activated actin cytoskeleton reorganisation." Cell Res. 16(9):759-770. PMID:16940963 - [
] Stuart JR, et al. (2006) "c-Abl interacts with the WAVE2 signaling complex to induce membrane ruffling and cell spreading." J Biol Chem. 281(42):31290-31297. PMID:16899465 - [
] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072 - [
] Kheir WA, et al. (2005) "A WAVE2-Abi1 complex mediates CSF-1-induced F-actin-rich membrane protrusions and migration in macrophages." J Cell Sci. 118(Pt 22):5369-5379. PMID:16280551 - [
] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073 - [
] Garcia-Garcia MJ, et al. (2005) "Analysis of mouse embryonic patterning and morphogenesis by forward genetics." Proc Natl Acad Sci U S A. 102(17):5913-5919. PMID:15755804 - [
] Papin J, et al. (2004) "Bioinformatics and cellular signaling." Curr Opin Biotechnol. 15(1):78-81. PMID:15102471 - [
] Steffen A, et al. (2004) "Sra-1 and Nap1 link Rac to actin assembly driving lamellipodia formation." EMBO J. 23(4):749-759. PMID:14765121 - [
] Echarri A, et al. (2004) "Abl interactor 1 (Abi-1) wave-binding and SNARE domains regulate its nucleocytoplasmic shuttling, lamellipodium localization, and wave-1 levels." Mol Cell Biol. 24(11):4979-4993. PMID:15143189 - [
] Blackshaw S, et al. (2004) "Genomic analysis of mouse retinal development." PLoS Biol. 2(9):E247. PMID:15226823 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Grove M, et al. (2004) "ABI2-deficient mice exhibit defective cell migration, aberrant dendritic spine morphogenesis, and deficits in learning and memory." Mol Cell Biol. 24(24):10905-10922. PMID:15572692 - [
] Watahiki A, et al. (2004) "Libraries enriched for alternatively spliced exons reveal splicing patterns in melanocytes and melanomas." Nat Methods. 1(3):233-239. PMID:15782199 - [
] Tani K, et al. (2003) "Abl interactor 1 promotes tyrosine 296 phosphorylation of mammalian enabled (Mena) by c-Abl kinase." J Biol Chem. 278(24):21685-21692. PMID:12672821 - [
] Innocenti M, et al. (2003) "Phosphoinositide 3-kinase activates Rac by entering in a complex with Eps8, Abi1, and Sos-1." J Cell Biol. 160(1):17-23. PMID:12515821 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851 - [
] Stradal T, et al. (2001) "The Abl interactor proteins localize to sites of actin polymerization at the tips of lamellipodia and filopodia." Curr Biol. 11(11):891-895. PMID:11516653 - [
] Ikeguchi A, et al. (2001) "Inhibition of v-Abl transformation in 3T3 cells overexpressing different forms of the Abelson interactor protein Abi-1." Oncogene. 20(36):4926-4934. PMID:11526477 - [
] Shibuya N, et al. (2001) "t(10;11)-acute leukemias with MLL-AF10 and MLL-ABI1 chimeric transcripts: specific expression patterns of ABI1 gene in leukemia and solid tumor cell lines." Genes Chromosomes Cancer. 32(1):1-10. PMID:11477655 - [
] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851 - [
] Courtney KD, et al. (2000) "Localization and phosphorylation of Abl-interactor proteins, Abi-1 and Abi-2, in the developing nervous system." Mol Cell Neurosci. 16(3):244-257. PMID:10995551 - [
] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861 - [
] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068 - [
] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159 - [
] Scita G, et al. (1999) "EPS8 and E3B1 transduce signals from Ras to Rac." Nature. 401(6750):290-293. PMID:10499589 - [
] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636 - [
] Xiong JW, et al. (1999) "Vezf1: A Zn finger transcription factor restricted to endothelial cells and their precursors." Dev Biol. 206(2):123-141. PMID:9986727 - [
] Zechner U, et al. (1998) "Characterization of the mouse Src homology 3 domain gene Sh3d2c on Chr 7 demonstrates coexpression with huntingtin in the brain and identifies the processed pseudogene Sh3d2c-ps1 on Chr 2." Genomics. 54(3):505-510. PMID:9878254 - [
] Biesova Z, et al. (1997) "Isolation and characterization of e3B1, an eps8 binding protein that regulates cell growth." Oncogene. 14(2):233-241. PMID:9010225 - [
] Shi Y, et al. (1995) "Abl-interactor-1, a novel SH3 protein binding to the carboxy-terminal portion of the Abl protein, suppresses v-abl transforming activity." Genes Dev. 9(21):2583-2597. PMID:7590237
IRSp53 is an essential intermediate between the activation of Rac and Cdc42 GTPases and the formation of cellular protrusions; it affects cell shape by coupling membrane-deforming activity with the actin cytoskeleton. IRSp53 is highly expressed in neurons where it is also an abundant component of the postsynaptic density (PSD). Here we analyze the physiological function of this protein in the mouse brain by generating IRSp53-deficient mice. Neurons in the hippocampus of young and adult knock-out (KO) mice do not exhibit morphological abnormalities in vivo. Conversely, primary cultured neurons derived from IRSp53 KO mice display retarded dendritic development in vitro. On a molecular level, Eps8 cooperates with IRSp53 to enhance actin bundling and interacts with IRSp53 in developing neurons. However, postsynaptic Shank proteins which are expressed at high levels in mature neurons compete with Eps8 to block actin bundling. In electrophysiological experiments the removal of IRSp53 increases synaptic plasticity as measured by augmented long term potentiation and paired-pulse facilitation. A primarily postsynaptic role of IRSp53 is underscored by the decreased size of the PSDs, which display increased levels of N-methyl-d-aspartate receptor subunits in IRSp53 KO animals. Our data suggest that the incorporation of IRSp53 into the PSD enables the protein to limit the number of postsynaptic glutamate receptors and thereby affect synaptic plasticity rather than dendritic morphology. Consistent with altered synaptic plasticity, IRSp53-deficient mice exhibit cognitive deficits in the contextual fear-conditioning paradigm.
Wiskott-Aldrich syndrome protein (WASP)-family verprolin homologous (WAVE) proteins play a major role in Rac-induced actin dynamics, but Rac does not bind directly to WAVE proteins. It has been proposed that either the insulin receptor substrate protein 53 (IRSp53) or a complex of proteins containing Abelson interactor protein 1 (Abi1) mediates the interaction of WAVE2 and Rac. Depletion of endogenous IRSp53 by RNA-mediated interference (RNAi) in a RAW/LR5 macrophage cell line resulted in a significant reduction of Rac1Q61L-induced surface ruffles and colony-stimulating factor 1 (CSF-1)-induced actin polymerization, protrusion and cell migration. However, IRSp53 was not essential for Fcgamma-R-mediated phagocytosis, formation of podosomes or for formation of Cdc42V12-induced filopodia. IRSp53 was found to be present in an immunoprecipitable complex with WAVE2 and Abi1 in a Rac1-activation-dependent manner in RAW/LR5 cells in vivo. Importantly, reduction of endogenous IRSp53 or expression of IRSp53 lacking the WAVE2-binding site (IRSp53DeltaSH3) resulted in a significant reduction in the association of Rac1 with WAVE2 and Abi1, indicating that the association of Rac1 with WAVE2 and Abi1 is IRSp53 dependent. While it has been proposed that WAVE2 activity is regulated by membrane recruitment, membrane targeting of WAVE2 in RAW/LR5 and Cos-7 cells did not induce actin polymerization or protrusion, suggesting that membrane recruitment was insufficient for regulation of WAVE2. Combined, these data suggest that IRSp53 links Rac1 to WAVE2 in vivo and its function is crucial for production of CSF-1-induced F-actin-rich protrusions and cell migration in macrophages. This study indicates that Rac1, along with IRSp53 and Abi1, is involved in a more complex and tight regulation of WAVE2 than one operating solely through membrane localization.
Actin polymerization is crucial in throm-bopoiesis, platelet adhesion, and mega-karyocyte (MK) and platelet spreading. The Wiskott-Aldrich syndrome protein (WASp) homolog WAVE functions downstream of Rac and plays a pivotal role in lamellipodia formation. While MKs and platelets principally express WAVE1 and WAVE2, which are associated with Abi1, the physiologic significance of WAVE isoforms remains undefined. We generated WAVE2(-/-) embryonic stem (ES) cells because WAVE2-null mice die by embryonic day (E) 12.5. We found that while WAVE2(-/-) ES cells differentiated into immature MKs on OP9 stroma, they were severely impaired in terminal differentiation and in platelet production. WAVE2(-/-) MKs exhibited a defect in peripheral lamellipodia on fibrinogen even with phorbol 12-myristate 13-acetate (PMA) costimulation, indicating a requirement of WAVE2 for integrin alpha(IIb)beta(3)-mediated full spreading. MKs in which expression of Abi1 was reduced by small interfering RNA (siRNA) exhibited striking similarity to WAVE2(-/-) MKs in maturation and spreading. Interestingly, the knockdown of IRSp53, a Rac effector that preferentially binds to WAVE2, impaired the development of lamellipodia without affecting proplatelet production. In contrast, thrombopoiesis in vivo and platelet spreading on fibrinogen in vitro were intact in WAVE1-null mice. These observations clarify indispensable roles for the WAVE2/Abi1 complex in alpha(IIb)beta(3)-mediated lamellipodia by MKs and platelets through Rac and IRSp53, and additionally in thrombopoiesis independent of Rac and IRSp53.
Activity-dependent protein phosphorylation is a highly dynamic yet tightly regulated process essential for cellular signaling. Although recognized as critical for neuronal functions, the extent and stoichiometry of phosphorylation in brain cells remain undetermined. In this study, we resolved activity-dependent changes in phosphorylation stoichiometry at specific sites in distinct subcellular compartments of brain cells. Following highly sensitive phosphopeptide enrichment using immobilized metal affinity chromatography and mass spectrometry, we isolated and identified 974 unique phosphorylation sites on 499 proteins, many of which are novel. To further explore the significance of specific phosphorylation sites, we used isobaric peptide labels and determined the absolute quantity of both phosphorylated and non-phosphorylated peptides of candidate phosphoproteins and estimated phosphorylation stoichiometry. The analyses of phosphorylation dynamics using differentially stimulated synaptic terminal preparations revealed activity-dependent changes in phosphorylation stoichiometry of target proteins. Using this method, we were able to differentiate between distinct isoforms of Ca2+/calmodulin-dependent protein kinase (CaMKII) and identify a novel activity-regulated phosphorylation site on the glutamate receptor subunit GluR1. Together these data illustrate that mass spectrometry-based methods can be used to determine activity-dependent changes in phosphorylation stoichiometry on candidate phosphopeptides following large scale phosphoproteome analysis of brain tissue.
BACKGROUND: The molecular reorganization of signaling molecules after T cell receptor (TCR) activation is accompanied by polymerization of actin at the site of contact between a T cell and an antigen-presenting cell (APC), as well as extension of actin-rich lamellipodia around the APC. Actin polymerization is critical for the fidelity and efficiency of the T cell response to antigen. The ability of T cells to polymerize actin is critical for several steps in T cell activation including TCR clustering, mature immunological synapse formation, calcium flux, IL-2 production, and proliferation. Activation of the Rac GTPase has been linked to regulation of actin polymerization after TCR stimulation. However, the molecules required for TCR-mediated actin polymerization downstream of activated Rac have remained elusive. Here we identify a novel role for the Abi/Wave protein complex, which signals downstream of activated Rac, in the regulation of actin polymerization and T cell activation in response to TCR stimulation. RESULTS: Here we show that Abi and Wave rapidly translocate from the T cell cytoplasm to the T cell:B cell contact site in the presence of antigen. Abi and Wave colocalize with actin at the T cell:B cell conjugation site. Moreover, Wave and Abi are necessary for actin polymerization after T cell activation, and loss of Abi proteins in mice impairs TCR-induced cell proliferation and IL-2 production in primary T cells. Significantly, the impairment in actin polymerization in cells lacking Abi proteins is due to the inability of Wave proteins to localize to the T cell:B cell contact site in the presence of antigen, rather than the destabilization of the components of the Wave protein complex. CONCLUSIONS: The Abi/Wave complex is a novel regulator of TCR-mediated actin dynamics, IL-2 production, and proliferation.
Dynamic cell movements and rearrangements are essential for the generation of the mammalian body plan, although relatively little is known about the genes that coordinate cell movement and cell fate. WAVE complexes are regulators of the actin cytoskeleton that couple extracellular signals to polarized cell movement. Here, we show that mouse embryos that lack Nap1, a regulatory component of the WAVE complex, arrest at midgestation and have defects in morphogenesis of all three embryonic germ layers. WAVE protein is not detectable in Nap1 mutants, and other components of the WAVE complex fail to localize to the surface of Nap1 mutant cells; thus loss of Nap1 appears to inactivate the WAVE complex in vivo. Nap1 mutants show specific morphogenetic defects: they fail to close the neural tube, fail to form a single heart tube (cardia bifida), and show delayed migration of endoderm and mesoderm. Other morphogenetic processes appear to proceed normally in the absence of Nap1/WAVE activity: the notochord, the layers of the heart, and the epithelial-to-mesenchymal transition (EMT) at gastrulation appear normal. A striking phenotype seen in approximately one quarter of Nap1 mutants is the duplication of the anteroposterior body axis. The axis duplications arise because Nap1 is required for the normal polarization and migration of cells of the Anterior Visceral Endoderm (AVE), an early extraembryonic organizer tissue. Thus, the Nap1 mutant phenotypes define the crucial roles of Nap1/WAVE-mediated actin regulation in tissue organization and establishment of the body plan of the mammalian embryo.
Abl interactor (Abi) was identified as an Abl tyrosine kinase-binding protein and subsequently shown to be a component of the macromolecular Abi/WAVE complex, which is a key regulator of Rac-dependent actin polymerization. Previous studies showed that Abi-1 promotes c-Abl-mediated phosphorylation of Mammalian Enabled (Mena) and WAVE2. In addition to Abi-1, mammals possess Abi-2 and NESH (Abi-3). In this study, we compared the three Abi proteins in terms of the promotion of c-Abl-mediated phosphorylation and the formation of Abi/WAVE complex. Although Abi-2, like Abi-1, promoted the c-Abl-mediated phosphorylation of Mena and WAVE2, NESH (Abi-3) had no such effect. This difference was likely due to their binding abilities as to c-Abl. Immunoprecipitation revealed that NESH (Abi-3) is present in the Abi/WAVE complex. Our results suggest that NESH (Abi-3), like Abi-1 and Abi-2, is a component of the Abi/WAVE complex, but likely plays a different role in the regulation of c-Abl.
Members of the Rho family of GTPases are key regulators of the actin cytoskeleton. In particular, activated Rac1 stimulates membrane dorsal ruffle formation in response to platelet-derived growth factor (PDGF). Abl-interactor (Abi)-1 and betaPIX, a guanine nucleotide exchange factor for Rac1, localise at these Rac1-induced actin structures and play important roles in the induction of membrane dorsal ruffling in response to PDGF in fibroblasts. Here, we demonstrate a novel interaction between Abi-1 and betaPIX using the yeast two-hybrid system, in vitro pull-down assays, and in vivo co-immunoprecipitation experiments. In vitro, the C-terminal fragment of betaPIX interacted with Abi-1, while in vivo the N-terminal fragment of betaPIX interacted with Abi-1. The biological function of this interaction was investigated in mouse fibroblasts in response to PDGF stimulation. Abi-1 and betaPIX co-localised in the cytoplasm and to membrane dorsal ruffles after PDGF treatment. We show that the co-expression of Abi-1 and truncated forms of betaPIX in mouse fibroblasts blocked PDGF-induced membrane dorsal ruffles. Together, these results show that the interaction between Abi-1 and betaPIX is involved in the formation of growth factor-induced membrane dorsal ruffles.
The Wiskott-Aldrich syndrome-related protein WAVE2 promotes Arp2/3-dependent actin polymerization downstream of Rho-GTPase activation. The Abelson-interacting protein-1 (Abi-1) forms the core of the WAVE2 complex and is necessary for proper stimulation of WAVE2 activity. Here we have shown that the Abl-tyrosine kinase interacts with the WAVE2 complex and that Abl kinase activity facilitates interaction between Abl and WAVE2 complex members. We have characterized various interactions between Abl and members of the WAVE2 complex and revealed that Abi-1 promotes interaction between Abl and WAVE2 members. We have demonstrated that Abl-dependent phosphorylation of WAVE2 is necessary for its activation in vivo, which is highlighted by the findings that RNA interference of WAVE2 expression in Abl/Arg-/- cells has no additive effect on the amount of membrane ruffling. Furthermore, Abl phosphorylates WAVE2 on tyrosine 150, and WAVE2-deficient cells rescued with a Y150F mutant fail to regain their ability to ruffle and form microspikes, unlike cells rescued with wild-type WAVE2. Together, these data show that c-Abl activates WAVE2 via tyrosine phosphorylation to promote actin remodeling in vivo and that Abi-1 forms the crucial link between these two factors.
This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins. Genomic mapping of the transcriptome reveals transcriptional forests, with overlapping transcription on both strands, separated by deserts in which few transcripts are observed. The data provide a comprehensive platform for the comparative analysis of mammalian transcriptional regulation in differentiation and development.
Colony-stimulating factor 1 (CSF-1) is an important physiological chemoattractant for macrophages. The mechanisms by which CSF-1 elicits the formation of filamentous actin (F-actin)-rich membrane protrusions and induces macrophage migration are not fully understood. In particular, very little is known regarding the contribution of the different members of the Wiskott-Aldrich Syndrome protein (WASP) family of actin regulators in response to CSF-1. Although a role for WASP itself in macrophage chemotaxis has been previously identified, no data was available regarding the function of WASP family verprolin-homologous (WAVE) proteins in this cell type. We found that WAVE2 was the predominant isoform to be expressed in primary macrophages and in cells derived from the murine monocyte/macrophage RAW264.7 cell line (RAW/LR5). CSF-1 treatment of macrophages resulted in WAVE2 accumulation in F-actin-rich protrusions induced by CSF-1. Inhibition of WAVE2 function by expressing a dominant-negative mutant or introducing anti-WAVE2 antibodies in RAW/LR5 cells, as well as reduction of endogenous WAVE2 expression by RNA-mediated interference (RNAi), resulted in a significant reduction of CSF-1-elicited F-actin protrusions. WAVE2 was found in a protein complex together with Abelson kinase interactor 1 (Abi1) in resting or stimulated cells. Both WAVE2 and Abi1 were recruited to and necessary for the formation of F-actin protrusions in response to CSF-1. Reducing the levels of WAVE2, directly or by targeting Abi1, resulted in an impaired cell migration to CSF-1. Altogether these data identify a WAVE2-Abi1 complex crucial for the normal actin cytoskeleton reorganization and migration of macrophages in response to CSF-1.
Antisense transcription (transcription from the opposite strand to a protein-coding or sense strand) has been ascribed roles in gene regulation involving degradation of the corresponding sense transcripts (RNA interference), as well as gene silencing at the chromatin level. Global transcriptome analysis provides evidence that a large proportion of the genome can produce transcripts from both strands, and that antisense transcripts commonly link neighboring "genes" in complex loci into chains of linked transcriptional units. Expression profiling reveals frequent concordant regulation of sense/antisense pairs. We present experimental evidence that perturbation of an antisense RNA can alter the expression of sense messenger RNAs, suggesting that antisense transcription contributes to control of transcriptional outputs in mammals.
Many aspects of the genetic control of mammalian embryogenesis cannot be extrapolated from other animals. Taking a forward genetic approach, we have induced recessive mutations by treatment of mice with ethylnitrosourea and have identified 43 mutations that affect early morphogenesis and patterning, including 38 genes that have not been studied previously. The molecular lesions responsible for 14 mutations were identified, including mutations in nine genes that had not been characterized previously. Some mutations affect vertebrate-specific components of conserved signaling pathways; for example, at least five mutations affect previously uncharacterized regulators of the Sonic hedgehog (Shh) pathway. Approximately half of all of the mutations affect the initial establishment of the body plan, and several of these produce phenotypes that have not been described previously. A large fraction of the genes identified affect cell migration, cellular organization, and cell structure. The findings indicate that phenotype-based genetic screens provide a direct and unbiased method to identify essential regulators of mammalian development.
The understanding of cellular function requires an integrated analysis of context-specific, spatiotemporal data from diverse sources. Recent advances in describing the genomic and proteomic 'parts list' of the cell and deciphering the interrelationship of these parts are described, including genome-wide location analysis, standards for microarray data analysis, and two-hybrid and mass spectrometry approaches. This information is being collected and curated in databases such as the Alliance for Cellular Signaling (AfCS) Molecule Pages, which will serve as vital tools for the reconstruction and analysis of cellular signaling networks.
The Rho-GTPase Rac1 stimulates actin remodelling at the cell periphery by relaying signals to Scar/WAVE proteins leading to activation of Arp2/3-mediated actin polymerization. Scar/WAVE proteins do not interact with Rac1 directly, but instead assemble into multiprotein complexes, which was shown to regulate their activity in vitro. However, little information is available on how these complexes function in vivo. Here we show that the specifically Rac1-associated protein-1 (Sra-1) and Nck-associated protein 1 (Nap1) interact with WAVE2 and Abi-1 (e3B1) in resting cells or upon Rac activation. Consistently, Sra-1, Nap1, WAVE2 and Abi-1 translocated to the tips of membrane protrusions after microinjection of constitutively active Rac. Moreover, removal of Sra-1 or Nap1 by RNA interference abrogated the formation of Rac-dependent lamellipodia induced by growth factor stimulation or aluminium fluoride treatment. Finally, microinjection of an activated Rac failed to restore lamellipodia protrusion in cells lacking either protein. Thus, Sra-1 and Nap1 are constitutive and essential components of a WAVE2- and Abi-1-containing complex linking Rac to site-directed actin assembly.
The Abl interactor 1 (Abi-1) protein has been implicated in the regulation of actin dynamics and localizes to the tips of lamellipodia and filopodia. Here, we show that Abi-1 binds the actin nucleator protein Wave-1 through an amino-terminal Wave-binding (WAB) domain and that disruption of the Abi-1-Wave-1 interaction prevents Abi-1 from reaching the tip of the lamellipodium. Abi-1 binds to the Wave homology domain of Wave-1, a region that is required for translocation of Wave-1 to the lamellipodium. Mouse embryo fibroblasts that lack one allele of Abi-1 and are homozygous null for the related Abi-2 protein exhibit decreased Wave-1 protein levels. This phenotype is rescued by Abi-1 proteins that retain Wave-1 binding but not by Abi-1 mutants that cannot bind to Wave-1. Moreover, we uncovered an overlapping SNARE domain in the amino terminus of Abi-1 that interacts with Syntaxin-1, a SNARE family member. Further, we demonstrated that Abi-1 shuttles in and out of the nucleus in a leptomycin B (LMB)-dependent manner and that complete nuclear translocation of Abi-1 in the absence of LMB requires the combined inactivation of the SNARE, WAB, and SH3 domains of Abi-1. Thus, Abi-1 undergoes nucleocytoplasmic shuttling and functions at the leading edge to regulate Wave-1 localization and protein levels.
The vertebrate retina is comprised of seven major cell types that are generated in overlapping but well-defined intervals. To identify genes that might regulate retinal development, gene expression in the developing retina was profiled at multiple time points using serial analysis of gene expression (SAGE). The expression patterns of 1,051 genes that showed developmentally dynamic expression by SAGE were investigated using in situ hybridization. A molecular atlas of gene expression in the developing and mature retina was thereby constructed, along with a taxonomic classification of developmental gene expression patterns. Genes were identified that label both temporal and spatial subsets of mitotic progenitor cells. For each developing and mature major retinal cell type, genes selectively expressed in that cell type were identified. The gene expression profiles of retinal Muller glia and mitotic progenitor cells were found to be highly similar, suggesting that Muller glia might serve to produce multiple retinal cell types under the right conditions. In addition, multiple transcripts that were evolutionarily conserved that did not appear to encode open reading frames of more than 100 amino acids in length ("noncoding RNAs") were found to be dynamically and specifically expressed in developing and mature retinal cell types. Finally, many photoreceptor-enriched genes that mapped to chromosomal intervals containing retinal disease genes were identified. These data serve as a starting point for functional investigations of the roles of these genes in retinal development and physiology.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
The Abl-interactor (Abi) family of adaptor proteins has been linked to signaling pathways involving the Abl tyrosine kinases and the Rac GTPase. Abi proteins localize to sites of actin polymerization in protrusive membrane structures and regulate actin dynamics in vitro. Here we demonstrate that Abi2 modulates cell morphogenesis and migration in vivo. Homozygous deletion of murine abi2 produced abnormal phenotypes in the eye and brain, the tissues with the highest Abi2 expression. In the absence of Abi2, secondary lens fiber orientation and migration were defective in the eye, without detectable defects in proliferation, differentiation, or apoptosis. These phenotypes were consistent with the localization of Abi2 at adherens junctions in the developing lens and at nascent epithelial cell adherens junctions in vitro. Downregulation of Abi expression by RNA interference impaired adherens junction formation and correlated with downregulation of the Wave actin-nucleation promoting factor. Loss of Abi2 also resulted in cell migration defects in the neocortex and hippocampus, abnormal dendritic spine morphology and density, and severe deficits in short- and long-term memory. These findings support a role for Abi2 in the regulation of cytoskeletal dynamics at adherens junctions and dendritic spines, which is critical for intercellular connectivity, cell morphogenesis, and cognitive functions.
It is becoming increasingly clear that alternative splicing enables the complex development and homeostasis of higher organisms. To gain a better understanding of how splicing contributes to regulatory pathways, we have developed an alternative splicing library approach for the identification of alternatively spliced exons and their flanking regions by alternative splicing sequence enriched tags sequencing. Here, we have applied our approach to mouse melan-c melanocyte and B16-F10Y melanoma cell lines, in which 5,401 genes were found to be alternatively spliced. These genes include those encoding important regulatory factors such as cyclin D2, Ilk, MAPK12, MAPK14, RAB4, melastatin 1 and previously unidentified splicing events for 436 genes. Real-time PCR further identified cell line-specific exons for Tmc6, Abi1, Sorbs1, Ndel1 and Snx16. Thus, the ASL approach proved effective in identifying splicing events, which suggest that alternative splicing is important in melanoma development.
Mammalian Enabled (Mena) is a mammalian homologue of Drosophila Enabled (Ena), which genetically interacts with Drosophila Abl tyrosine kinase. The signaling pathway involving c-Abl and Mena (Ena) is not fully understood. To find molecules that participate in the c-Abl/Mena pathway, we searched for Mena-binding proteins using a yeast two-hybrid system. We identified Abl interactor 1 (Abi-1), which is known to interact with c-Abl, as a binding protein for Mena. Binding analysis revealed that the Ena/Vasp homology 1 domain of Mena and the polyproline structure of Abi-1 are necessary for the interaction. The interaction between Mena and Abi-1 was also observed in a mammalian expression system. Importantly, Abi-1 dramatically promoted c-Abl-mediated tyrosine phosphorylation of Mena but not other substrates such as c-Cbl. Mutational analysis demonstrated that the phosphorylation site of Mena is Tyr-296. Our results suggest that Abi-1 regulates c-Abl-mediated phosphorylation of Mena by interacting with both proteins.
Class I phosphoinositide 3-kinases (PI3Ks) are implicated in many cellular responses controlled by receptor tyrosine kinases (RTKs), including actin cytoskeletal remodeling. Within this pathway, Rac is a key downstream target/effector of PI3K. However, how the signal is routed from PI3K to Rac is unclear. One possible candidate for this function is the Rac-activating complex Eps8-Abi1-Sos-1, which possesses Rac-specific guanine nucleotide exchange factor (GEF) activity. Here, we show that Abi1 (also known as E3b1) recruits PI3K, via p85, into a multimolecular signaling complex that includes Eps8 and Sos-1. The recruitment of p85 to the Eps8-Abi1-Sos-1 complex and phosphatidylinositol 3, 4, 5 phosphate (PIP3), the catalytic product of PI3K, concur to unmask its Rac-GEF activity in vitro. Moreover, they are indispensable for the activation of Rac and Rac-dependent actin remodeling in vivo. On growth factor stimulation, endogenous p85 and Abi1 consistently colocalize into membrane ruffles, and cells lacking p85 fail to support Abi1-dependent Rac activation. Our results define a mechanism whereby propagation of signals, originating from RTKs or Ras and leading to actin reorganization, is controlled by direct physical interaction between PI3K and a Rac-specific GEF complex.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
Only a small proportion of the mouse genome is transcribed into mature messenger RNA transcripts. There is an international collaborative effort to identify all full-length mRNA transcripts from the mouse, and to ensure that each is represented in a physical collection of clones. Here we report the manual annotation of 60,770 full-length mouse complementary DNA sequences. These are clustered into 33,409 'transcriptional units', contributing 90.1% of a newly established mouse transcriptome database. Of these transcriptional units, 4,258 are new protein-coding and 11,665 are new non-coding messages, indicating that non-coding RNA is a major component of the transcriptome. 41% of all transcriptional units showed evidence of alternative splicing. In protein-coding transcripts, 79% of splice variations altered the protein product. Whole-transcriptome analyses resulted in the identification of 2,431 sense-antisense pairs. The present work, completely supported by physical clones, provides the most comprehensive survey of a mammalian transcriptome so far, and is a valuable resource for functional genomics.
Cell movement is mediated by the protrusion of cytoplasm in the form of sheet- and rod-like extensions, termed lamellipodia and filopodia. Protrusion is driven by actin polymerization, a process that is regulated by signaling complexes that are, as yet, poorly defined. Since actin assembly is controlled at the tips of lamellipodia and filopodia [1], these juxtamembrane sites are likely to harbor the protein complexes that control actin polymerization dynamics underlying cell motility. An understanding of the regulation of protrusion therefore requires the characterization of the molecular components recruited to these sites. The Abl interactor (Abi) proteins, targets of Abl tyrosine kinases [2-4], have been implicated in Rac-dependent cytoskeletal reorganization in response to growth factor stimulation [5]. Here, we describe the unique localization of Abi proteins in living, motile cells. We show that Abi-1 and Abi-2b fused to enhanced yellow fluorescent protein (EYFP) are recruited to the tips of lamellipodia and filopodia. We identify the targeting domain as the homologous N terminus of these two proteins. Our findings are the first to suggest a direct involvement of members of the Abi protein family in the control of actin polymerization in protrusion events, and establish the Abi proteins as potential regulators of motility.
The abi-1 gene encodes a protein that binds and is phosphorylated by the Abelson protein tyrosine kinase. Constructs expressing a full-length abi-1 cDNA, and a smaller cDNA arising from an alternatively spliced form, were generated and tested for their effect on transformation of NIH3T3 cells by the Abelson murine leukemia virus. Overexpression of both forms of the protein strongly inhibited transformation by the wild-type P160 strain of the virus, but not by the non-interacting mutant P90A strain. The inhibition required the SH3 domain of Abi-1, suggesting that a direct interaction was required for the effect. Rare breakthrough P160 transformants of the Abi-1 overexpressing lines were found to have downregulated Abi-1 protein levels by a post-transcriptional mechanism.
The recurrent translocation t(10;11) is associated with acute myeloid leukemia (AML). The AF10 gene on chromosome 10 at band p12 and MLL at 11q23 fuse in the t(10;11)(p12;q23). Recently, we have identified ABI1 as a new partner gene for MLL in an AML patient with a t(10;11)(p11.2;q23). The ABI1 is a human homologue of the mouse Abl-interactor 1 (Abi1), encoding an Abl-binding protein. The ABI1 protein exhibits sequence similarity to homeotic genes, and contains several polyproline stretches and a src homology 3 (SH3) domain. To clarify the clinical features of t(10;11)-leukemias, we investigated 6 samples from acute leukemia patients with t(10;11) and MLL rearrangement and detected MLL-AF10 chimeric transcripts in 5 samples and MLL-ABI1 in one. The patient with MLL-ABI1 chimeric transcript is the second case described, thus confirming that the fusion of the MLL and ABI1 genes is a recurring abnormality. Both of the patients with MLL-ABI1 chimeric transcript are surviving, suggesting that these patients have a better prognosis than the patients with MLL-AF10. To investigate the roles of AF10 and ABI1 further, we examined the expression of these genes in various cell lines and fresh tumor samples using the reverse transcriptase-polymerase chain reaction method. Although AF10 was expressed in almost all cell lines similarly, the expression patterns of ABI1 were different between leukemia and solid tumor cell lines, suggesting the distinctive role of each isoform of ABI1 in these cell lines. We also determined the complete mouse Abi1 sequence and found that the sequence matched with human ABI1 better than the originally reported Abi1 sequence. Further functional analysis of the MLL-AF10 and MLL-ABI1 fusion proteins will provide new insights into the leukemogenesis of t(10;11)-AML.
The RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full-length complementary DNAs and physical mapping of the corresponding genes to the mouse genome. We organized an international functional annotation meeting (FANTOM) to annotate the first 21,076 cDNAs to be analysed in this project. Here we describe the first RIKEN clone collection, which is one of the largest described for any organism. Analysis of these cDNAs extends known gene families and identifies new ones.
Abl-interactor (Abi) proteins are targets of Abl-family nonreceptor tyrosine kinases and are required for Rac-dependent cytoskeletal reorganization in response to growth factor stimulation. We asked if the expression, phosphorylation, and cellular localization of Abi-1 and Abi-2 supports a role for these proteins in Abl signaling in the developing and adult mouse nervous system. In mid- to late-gestation embryos, abi-2 message is elevated in the central and peripheral nervous systems (CNS and PNS). Abi-1 mRNA is present, but not enhanced, in the CNS, and is not observed in PNS structures. Abi proteins from brain lysates undergo changes in apparent molecular weight and phosphorylation with increasing age. In the postnatal brain, abi-1 and abi-2 are expressed most prominently in cortical layers populated by projection neurons. In cultured neurons, Abi-1 and Abi-2 are concentrated in puncta throughout the cell body and processes. Both Abi and Abl proteins are present in synaptosomes and growth cone particles. Therefore, the Abi adaptors exhibit proper expression patterns and subcellular localization to participate in Abl kinase signaling in the nervous system.
The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3' end and 5' end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month.
cDNA microarray technology has been increasingly used to monitor global gene expression patterns in various tissues and cell types. However, applications to mammalian development have been hampered by the lack of appropriate cDNA collections, particularly for early developmental stages. To overcome this problem, a PCR-based cDNA library construction method was used to derive 52,374 expressed sequence tags from pre- and peri-implantation embryos, embryonic day (E) 12.5 female gonad/mesonephros, and newborn ovary. From these cDNA collections, a microarray representing 15,264 unique genes (78% novel and 22% known) was assembled. In initial applications, the divergence of placental and embryonic gene expression profiles was assessed. At stage E12.5 of development, based on triplicate experiments, 720 genes (6.5%) displayed statistically significant differences in expression between placenta and embryo. Among 289 more highly expressed in placenta, 61 placenta-specific genes encoded, for example, a novel prolactin-like protein. The number of genes highly expressed (and frequently specific) for placenta has thereby been increased 5-fold over the total previously reported, illustrating the potential of the microarrays for tissue-specific gene discovery and analysis of mammalian developmental programs.
In the effort to prepare the mouse full-length cDNA encyclopedia, we previously developed several techniques to prepare and select full-length cDNAs. To increase the number of different cDNAs, we introduce here a strategy to prepare normalized and subtracted cDNA libraries in a single step. The method is based on hybridization of the first-strand, full-length cDNA with several RNA drivers, including starting mRNA as the normalizing driver and run-off transcripts from minilibraries containing highly expressed genes, rearrayed clones, and previously sequenced cDNAs as subtracting drivers. Our method keeps the proportion of full-length cDNAs in the subtracted/normalized library high. Moreover, our method dramatically enhances the discovery of new genes as compared to results obtained by using standard, full-length cDNA libraries. This procedure can be extended to the preparation of full-length cDNA encyclopedias from other organisms.
The small guanine nucleotide (GTP)-binding protein Rac regulates mitogen-induced cytoskeletal changes and c-Jun amino-terminal kinase (JNK), and its activity is required for Ras-mediated cell transformation. Epistatic analysis placed Rac as a key downstream target in Ras signalling; however, the biochemical mechanism regulating the cross-talk among these small GTP-binding proteins remains to be elucidated. Eps8 (relative molecular mass 97,000) is a substrate of receptors with tyrosine kinase activity which binds, through its SH3 domain, to a protein designated E3b1/Abi-1. Here we show that Eps8 and E3b1/Abi-1 participate in the transduction of signals from Ras to Rac, by regulating Rac-specific guanine nucleotide exchange factor (GEF) activities. We also show that Eps8, E3b1 and Sos-1 form a tri-complex in vivo that exhibits Rac-specific GEF activity in vitro. We propose a model in which Eps8 mediates the transfer of signals between Ras and Rac, by forming a complex with E3b1 and Sos-1.
Using retroviral entrapment vectors, we identified a novel mouse gene whose expression is restricted to vascular endothelial cells and their precursors in the yolk sac blood islands. A 3.68-kb cDNA corresponding to the endogenous transcript was isolated using genomic DNA flanking the entrapment vector insertion as a probe. We have named this gene Vezf1 for vascular endothelial zinc finger 1. Vezf1 encodes a protein with a predicted molecular mass of 56 kDa and that contains six putative zinc finger domains and shows high homology to a previously identified human gene, DB1, that is believed to be involved in regulating expression of cytokine genes such as interleukin-3. In situ hybridization analysis revealed the onset of expression in advanced primitive streak-stage embryos being located in the extraembryonic mesodermal component of the visceral yolk sac and in the anteriormost mesoderm of the embryo proper. During head-fold and somite stages, expression was restricted to vascular endothelial cells that arise during both vasculogenesis and angiogenesis. Vezf1-related sequences were found to be highly conserved among higher vertebrate species that have acquired extraembryonic yolk sac membranes during evolution. The Vezf1 locus mapped to the proximal part of mouse chromosome 2, a region which has homology to human chromosome 9q. Vezf1 expression correlates temporally and spatially with the early differentiation of angioblasts into the endothelial cell lineage and the proliferation of endothelial cells of the embryonic vascular system. Thus, Vezf1 may play an important role in the endothelial lineage determination and may have an additional role during later stages of embryonic vasculogenesis and angiogenesis.
Formation of intracellular protein complexes is often mediated by Src homology 3 domain-containing proteins interacting with proline-rich target sequences on other proteins. The Sh3d2c gene or its rat/human orthologs have been implicated in synaptic vesicle recycling due to interaction with dynamin I and synaptojanin in nerve terminals. In a yeast two-hybrid system, association with a huntingtin fragment containing an elongated stretch of polyglutamines was observed recently. By genetic mapping and fluorescence in situ hybridization we demonstrate the localization of Sh3d2c on mouse chromosome 7. A processed pseudogene of Sh3d2c, Sh3d2c-ps1, was identified and mapped to mouse chromosome 2. Using RNA in situ hybridization, we show that Sh3d2c is transcribed in various regions of the brain. The striatum, hippocampus, cortex, basal hypothalamus, brain stem, and cerebellum are the most prominent sites of expression. Because huntingtin and Sh3d2c are coexpressed in most regions of the brain, it can be speculated that there is a link between the association of huntingtin/Sh3d2c and the pathogenesis of Huntington disease.
Eps8, a substrate of receptor tyrosine kinases, is an SH3 domain containing protein that plays an important role in mitogenic signaling. To determine the cellular function of eps8, we used the SH3 domain of eps8 to screen a human fibroblast M426 expression library and identified, a full-length cDNA clone of 3.2 kb. We designated this clone e3B1 for eps8 SH3 domain binding protein 1. Northern analysis revealed that expression of e3B1 mRNA was ubiquitous in human tissues. The e3B1 gene encodes a SH3 domain containing protein. We show that anti-e3B1 antibodies detect three cytosolic protein species of 65, 68 and 72 kDa in cell lysate isolated from asynchronously growing NIH3T3 cells. E3B1 binds to the SH3 domain of eps8 and Abl in vitro. We also demonstrated that e3B1 associates with eps8 in vivo. Phosphatase digestion and phosphoamino acid analysis revealed that p65e3B1 is a phosphoserine containing protein and p72e3B1 and p68e3B1 are hyperserine-phosphorylated form of p65e3B1. We further determined that the p65e3B1 was the most abundant in serum-starved NIH/EGFR cells. Time course studies initiated by the addition of epidermal growth factor (EGF) revealed that the p72e3B1 started to accumulate at 4 h, peaked at 8 h and remained high until 24 h. Finally, we demonstrate that NIH/EGFR fibroblasts overexpressing e3B1 grow more slowly relative to matched controls.
A novel cellular protein, Abl-interactor-1 (Abi-1), which specifically interacts with the carboxy-terminal region of Abl oncoproteins, has been identified in a mouse leukemia cell line. The protein exhibits sequence similarity to homeotic genes, contains several polyproline stretches, and includes a src homology 3 (SH3) domain at its very carboxyl terminus that is required for binding to Abl proteins. The abi-1 gene has been mapped to mouse chromosome 2 and is genetically closely linked to the c-abl locus. The gene is widely expressed in the mouse, with highest levels of mRNA found in the bone marrow, spleen, brain, and testes. The Abi-1 protein coimmunoprecipitates with v-Abl and serves as a substrate for kinase activity. When overexpressed in NIH-3T3 cells, abi-1 potently suppresses the transforming activity of Abelson leukemia virus expressing the full-length p160v-abl kinase but does not affect the transforming activity of viruses expressing a truncated p90v-abl or v-src kinases. We suggest that the Abi-1 protein may serve as a regulator of Abl function in transformation or in signal transduction.