Aanat | GeneID:11298 | Mus musculus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 11298 | Official Symbol | Aanat |
|---|---|---|---|
| Locus | RP23-313J14.2 | Gene Type | protein-coding |
| Synonyms | MGC151344; Nat-2; Nat4; SNAT | ||
| Full Name | arylalkylamine N-acetyltransferase | ||
| Description | arylalkylamine N-acetyltransferase | ||
| Chromosome | 11 E2|11 70.0 cM | ||
| Also Known As | OTTMUSP00000004270 | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 31013
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:15 | AANAT | NP_001079.1 | Homo sapiens |
| GeneID:11298 | Aanat | NP_033721.1 | Mus musculus |
| GeneID:25120 | Aanat | NP_036950.1 | Rattus norvegicus |
| GeneID:281583 | AANAT | NP_803475.1 | Bos taurus |
| GeneID:393677 | aanat1 | NP_956998.1 | Danio rerio |
| GeneID:396066 | AANAT | NP_990489.1 | Gallus gallus |
| GeneID:483331 | AANAT | XP_540450.1 | Canis lupus familiaris |
| GeneID:503504 | AANAT | NP_001012442.1 | Pan troglodytes |
| GeneID:618594 | AANAT | XP_876019.2 | Bos taurus |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | acris | SP5276CP | Serotonin acetylase Control Peptide; antibody Ab/CP |
| 2 | acris | SP5277CP | Serotonin acetylase pThr29, Control Peptide; antibody Ab/CP |
| 3 | acris | SP5276P | Serotonin acetylase; antibody Ab |
| 4 | acris | SP5277P | Serotonin acetylase pThr29; antibody Ab |
| 5 | sigma | S0564 | Anti-Serotonin N-Acetyltransferase (N-Terminal) antibody produced in rabbit ; |
| 6 | sigma | S0689 | Anti-Serotonin N-Acetyltransferase (C-Terminal) antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0008415 | Function | acyltransferase activity |
| GO:0004059 | Function | aralkylamine N-acetyltransferase activity |
| GO:0004060 | Function | arylamine N-acetyltransferase activity |
| GO:0008080 | Function | N-acetyltransferase activity |
| GO:0005184 | Function | neuropeptide hormone activity |
| GO:0016740 | Function | transferase activity |
| GO:0030187 | Process | melatonin biosynthetic process |
| GO:0008152 | Process | metabolic process |
| GO:0048511 | Process | rhythmic process |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSMUST00000021160 | MI0004998 | gga-miR-460 | CCUGCAUUGUACACACUGUGUG |
| ENSMUST00000021160 | MI0003195 | hsa-miR-508-5p | UACUCCAGAGGGCGUCACUCAUG |
| ENSMUST00000021160 | MI0003180 | hsa-miR-516a-5p | UUCUCGAGGAAAGAAGCACUUUC |
| ENSMUST00000021160 | MI0003181 | hsa-miR-516a-5p | UUCUCGAGGAAAGAAGCACUUUC |
| ENSMUST00000021160 | MI0003564 | hsa-miR-558 | UGAGCUGCUGUACCAAAAU |
| ENSMUST00000021160 | MI0003570 | hsa-miR-564 | AGGCACGGUGUCAGCAGGC |
| ENSMUST00000021160 | MI0003605 | hsa-miR-593 | UGUCUCUGCUGGGGUUUCU |
| ENSMUST00000021160 | MI0003618 | hsa-miR-605 | UAAAUCCCAUGGUGCCUUCUCCU |
| ENSMUST00000021160 | MI0003652 | hsa-miR-637 | ACUGGGGGCUUUCGGGCUCUGCGU |
| ENSMUST00000021160 | MI0003661 | hsa-miR-646 | AAGCAGCUGCCUCUGAGGC |
| ENSMUST00000021160 | MI0003662 | hsa-miR-647 | GUGGCUGCACUCACUUCCUUC |
| ENSMUST00000021160 | MI0003665 | hsa-miR-650 | AGGAGGCAGCGCUCUCAGGAC |
| ENSMUST00000021160 | MI0003682 | hsa-miR-658 | GGCGGAGGGAAGUAGGUCCGUUGGU |
| ENSMUST00000021160 | MI0003670 | hsa-miR-662 | UCCCACGUUGUGGCCCAGCAG |
| ENSMUST00000021160 | MI0005562 | hsa-miR-887 | GUGAACGGGCGCCAUCCCGAGG |
| ENSMUST00000021160 | MI0005755 | hsa-miR-933 | UGUGCGCAGGGAGACCUCUCCC |
| ENSMUST00000021160 | MI0005758 | hsa-miR-936 | ACAGUAGAGGGAGGAAUCGCAG |
| ENSMUST00000021160 | MI0005760 | hsa-miR-938 | UGCCCUUAAAGGUGAACCCAGU |
| ENSMUST00000021160 | MI0005767 | hsa-miR-942 | UCUUCUCUGUUUUGGCCAUGUG |
| ENSMUST00000021160 | MI0000585 | mmu-miR-129-3p | AAGCCCUUACCCCAAAAAGCAU |
| ENSMUST00000021160 | MI0000693 | mmu-miR-139-3p | UGGAGACGCGGCCCUGUUGGAG |
| ENSMUST00000021160 | MI0000171 | mmu-miR-149 | UCUGGCUCCGUGUCUUCACUCCC |
| ENSMUST00000021160 | MI0000175 | mmu-miR-153 | UUGCAUAGUCACAAAAGUGAUC |
| ENSMUST00000021160 | MI0000233 | mmu-miR-191* | GCUGCACUUGGAUUUCGUUCCC |
| ENSMUST00000021160 | MI0000241 | mmu-miR-199a-5p | CCCAGUGUUCAGACUACCUGUUC |
| ENSMUST00000021160 | MI0000713 | mmu-miR-199a-5p | CCCAGUGUUCAGACUACCUGUUC |
| ENSMUST00000021160 | MI0000714 | mmu-miR-199b* | CCCAGUGUUUAGACUACCUGUUC |
| ENSMUST00000021160 | MI0000248 | mmu-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
| ENSMUST00000021160 | MI0000568 | mmu-miR-20a* | ACUGCAUUACGAGCACUUAAAG |
| ENSMUST00000021160 | MI0000731 | mmu-miR-217 | UACUGCAUCAGGAACUGACUGGA |
| ENSMUST00000021160 | MI0000711 | mmu-miR-224 | UAAGUCACUAGUGGUUCCGUU |
| ENSMUST00000021160 | MI0000689 | mmu-miR-25 | CAUUGCACUUGUCUCGGUCUGA |
| ENSMUST00000021160 | MI0000575 | mmu-miR-26b* | CCUGUUCUCCAUUACUUGGCUC |
| ENSMUST00000021160 | MI0000398 | mmu-miR-298 | GGCAGAGGAGGGCUGUUCUUCCC |
| ENSMUST00000021160 | MI0000400 | mmu-miR-300* | UUGAAGAGAGGUUAUCCUUUGU |
| ENSMUST00000021160 | MI0000144 | mmu-miR-30a | UGUAAACAUCCUCGACUGGAAG |
| ENSMUST00000021160 | MI0000145 | mmu-miR-30b | UGUAAACAUCCUACACUCAGCU |
| ENSMUST00000021160 | MI0000549 | mmu-miR-30d | UGUAAACAUCCCCGACUGGAAG |
| ENSMUST00000021160 | MI0000579 | mmu-miR-31 | AGGCAAGAUGCUGGCAUAGCUG |
| ENSMUST00000021160 | MI0000603 | mmu-miR-328 | CUGGCCCUCUCUGCCCUUCCGU |
| ENSMUST00000021160 | MI0000607 | mmu-miR-330 | UCUCUGGGCCUGUGUCUUAGGC |
| ENSMUST00000021160 | MI0005494 | mmu-miR-343 | UCUCCCUUCAUGUGCCCAGA |
| ENSMUST00000021160 | MI0000643 | mmu-miR-351 | UCCCUGAGGAGCCCUUUGAGCCUG |
| ENSMUST00000021160 | MI0003531 | mmu-miR-367 | AAUUGCACUUUAGCAAUGGUGA |
| ENSMUST00000021160 | MI0003537 | mmu-miR-450a-3p | AUUGGGGAUGCUUUGCAUUCAU |
| ENSMUST00000021160 | MI0004705 | mmu-miR-450b-3p | AUUGGGAACAUUUUGCAUGCAU |
| ENSMUST00000021160 | MI0005497 | mmu-miR-453 | AGGUUGCCUCAUAGUGAGCUUGCA |
| ENSMUST00000021160 | MI0002398 | mmu-miR-463 | UGAUAGACACCAUAUAAGGUAG |
| ENSMUST00000021160 | MI0002400 | mmu-miR-465a-3p | GAUCAGGGCCUUUCUAAGUAGA |
| ENSMUST00000021160 | MI0005512 | mmu-miR-467c | UAAGUGCGUGCAUGUAUAUGUG |
| ENSMUST00000021160 | MI0005513 | mmu-miR-467d | UAAGUGCGCGCAUGUAUAUGCG |
| ENSMUST00000021160 | MI0002404 | mmu-miR-469 | UGCCUCUUUCAUUGAUCUUGGUGUCC |
| ENSMUST00000021160 | MI0005516 | mmu-miR-509-5p | UACUCCAGAAUGUGGCAAUCAU |
| ENSMUST00000021160 | MI0005554 | mmu-miR-511 | AUGCCUUUUGCUCUGCACUCA |
| ENSMUST00000021160 | MI0003206 | mmu-miR-532-3p | CCUCCCACACCCAAGGCUUGCA |
| ENSMUST00000021160 | MI0004171 | mmu-miR-665 | ACCAGGAGGCUGAGGUCCCU |
| ENSMUST00000021160 | MI0004553 | mmu-miR-666-5p | AGCGGGCACAGCUGUGAGAGCC |
| ENSMUST00000021160 | MI0004133 | mmu-miR-671-3p | UCCGGUUCUCAGGGCUCCACC |
| ENSMUST00000021160 | MI0004601 | mmu-miR-673-3p | UCCGGGGCUGAGUUCUGUGCACC |
| ENSMUST00000021160 | MI0004123 | mmu-miR-675-5p | UGGUGCGGAAAGGGCCCACAGU |
| ENSMUST00000021160 | MI0005003 | mmu-miR-676 | CCGUCCUGAGGUUGUUGAGCU |
| ENSMUST00000021160 | MI0004643 | mmu-miR-681 | CAGCCUCGCUGGCAGGCAGCU |
| ENSMUST00000021160 | MI0004654 | mmu-miR-689 | CGUCCCCGCUCGGCGGGGUCC |
| ENSMUST00000021160 | MI0004655 | mmu-miR-689 | CGUCCCCGCUCGGCGGGGUCC |
| ENSMUST00000021160 | MI0004681 | mmu-miR-697 | AACAUCCUGGUCCUGUGGAGA |
| ENSMUST00000021160 | MI0004693 | mmu-miR-709 | GGAGGCAGAGGCAGGAGGA |
| ENSMUST00000021160 | MI0004651 | mmu-miR-719 | AUCUCGGCUACAGAAAAAUGUU |
| ENSMUST00000021160 | MI0004215 | mmu-miR-762 | GGGGCUGGGGCCGGGACAGAGC |
| ENSMUST00000021160 | MI0004310 | mmu-miR-764-3p | AGGAGGCCAUAGUGGCAACUGU |
| ENSMUST00000021160 | MI0004203 | mmu-miR-770-3p | CGUGGGCCUGACGUGGAGCUGG |
| ENSMUST00000021160 | MI0005551 | mmu-miR-875-5p | UAUACCUCAGUUUUAUCAGGUG |
| ENSMUST00000021160 | MI0005553 | mmu-miR-877 | GUAGAGGAGAUGGCGCAGGG |
| ENSMUST00000021160 | MI0005548 | mmu-miR-878-5p | UAUCUAGUUGGAUGUCAAGACA |
| ENSMUST00000021160 | MI0000581 | mmu-miR-93* | ACUGCUGAGCUAGCACUUCCCG |
| ENSMUST00000021160 | MI0000613 | rno-miR-336 | UCACCCUUCCAUAUCUAGUCU |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Klein DC, et al. (2007) "Arylalkylamine N-acetyltransferase: "the Timezyme"." J Biol Chem. 282(7):4233-4237. PMID:17164235 - [
] Simonneaux V, et al. (2006) "Rat and Syrian hamster: two models for the regulation of AANAT gene expression." Chronobiol Int. 23(1-2):351-359. PMID:16687308 - [
] Slominski A, et al. (2003) "Characterization of the serotoninergic system in the C57BL/6 mouse skin." Eur J Biochem. 270(16):3335-3344. PMID:12899690 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Uz T, et al. (2002) "Circadian differences in behavioral sensitization to cocaine: putative role of arylalkylamine N-acetyltransferase." Life Sci. 70(25):3069-3075. PMID:12138020 - [
] Stanley LA, et al. (1998) "Immunochemical detection of arylamine N-acetyltransferase during mouse embryonic development and in adult mouse brain." Teratology. 58(5):174-182. PMID:9839355 - [
] Sakamoto K, et al. (1998) "Molecular cloning of serotonin N-acetyltransferase gene from the mouse and its daily expression in the retina." Neurosci Lett. 250(3):181-184. PMID:9708862 - [
] Roseboom PH, et al. (1998) "Natural melatonin 'knockdown' in C57BL/6J mice: rare mechanism truncates serotonin N-acetyltransferase." Brain Res Mol Brain Res. 63(1):189-197. PMID:9838107 - [
] Yoshimura T, et al. (1997) "Chromosomal mapping of the gene encoding serotonin N-acetyltransferase to rat chromosome 10q32.3 and mouse chromosome 11E2." Cytogenet Cell Genet. 79(3-4):172-175. PMID:9605843 - [
] Goto M, et al. (1994) "The locus controlling pineal serotonin N-acetyltransferase activity (Nat-2) is located on mouse chromosome 11." Brain Res Mol Brain Res. 21(3-4):349-354. PMID:8170356 - [
] Kelly SL, et al. (1994) "Arylamine N-acetyltransferase in Balb/c mice: identification of a novel mouse isoenzyme by cloning and expression in vitro." Biochem J. 302 ( Pt 2)():347-353. PMID:7545952 - [
] Ebihara S, et al. (1986) "Genetic control of melatonin synthesis in the pineal gland of the mouse." Science. 231(4737):491-493. PMID:3941912
Arylalkylamine N-acetyltransferase controls daily changes in melatonin production by the pineal gland and thereby plays a unique role in biological timing in vertebrates. Arylalkylamine N-acetyltransferase is also expressed in the retina, where it may play other roles in addition to signaling, including neurotransmission and detoxification. Large changes in activity reflect cyclic 3',5'-adenosine monophosphate-dependent phosphorylation of arylalkylamine N-acetyltransferase, leading to formation of a regulatory complex with 14-3-3 proteins. This activates the enzyme and prevents proteosomal proteolysis. The conserved features of regulatory systems that control arylalkylamine N-acetyltransferase are a circadian clock and environmental lighting.
The Syrian hamster is a rodent species in which the photoperiodic change in the melatonin peak duration is pivotal for the synchronization of annual functions, like reproduction. In this species, the activity of arylalkylamine N-acetyltransferase (AANAT), the key enzyme for the rhythmic synthesis of melatonin, is precisely controlled and time-gated, suggesting regulatory mechanisms different from those in the rat or mouse. At the beginning of the night, norepinephrine (NE) elicits a rapid and sustained phosphorylation of CREB into pCREB and a transient synthesis of the immediate early gene products c-FOS and c-JUN that peak 3 h after dark onset. c-FOS synthesis requires both pCREB and the pERK1/2 pathways. Interestingly, injection of the protein synthesis inhibitor cycloheximide before, but not after, the c-FOS/c-JUN peak markedly reduces Aanat mRNA levels. This finding suggests that the c-FOS/c-JUN dimer is required for transcriptional activation of the Aanat gene. During daylight, exogenous noradrenergic stimulation cannot stimulate Aanat expression and, therefore, melatonin synthesis. The inhibitory transcription factor ICER is present in the pineal gland but with highest values when AANAT may be activated, suggesting the blockade takes place upstream of Aanat expression. Preliminary experiments indicate that the diurnal inhibition of AANAT occurs at the level of the adrenergic receptor signalling pathway, but it is not known whether this is sufficient to explain the pineal resistance to NE during the daytime. Together, these findings demonstrate that AANAT regulation in the Syrian hamster requires a complex intracellular signalling cascade, different from that described in laboratory rodents like mice and rats.
We showed expression of the tryptophan hydroxylase gene and of tryptophan hydroxylase protein immunoreactivity in mouse skin and skin cells. Extracts from skin and melanocyte samples acetylated serotonin to N-acetylserotonin and tryptamine to N-acetyltryptamine. A different enzyme from arylalkylamine N-acetyltransferase mediated this reaction, as this gene was defective in the C57BL6 mouse, coding predominantly for a protein without enzymatic activity. Serotonin (but not tryptamine) acetylation varied according to hair cycle phase and anatomic location. Serotonin was also metabolized to 5-hydroxytryptophol and 5-hydroxyindole acetic acid, probably through stepwise transformation catalyzed by monoamine oxidase, aldehyde dehydrogenase and aldehyde reductase. Activity of the melatonin-forming enzyme hydroxyindole-O-methyltransferase was notably below detectable levels in all samples of mouse corporal skin, although it was detectable at low levels in the ears and in Cloudman melanoma (derived from the DBA/2 J mouse strain). In conclusion, mouse skin has the molecular and biochemical apparatus necessary to produce and metabolize serotonin and N-acetylserotonin, and its activity is determined by topography, physiological status of the skin, cell type and mouse strain.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
Circadian rhythms might be involved in addictive behaviors. The pineal secretory product melatonin decreases cocaine sensitization in rats; mice mutant for the critical melatonin-synthesizing enzyme, arylalkylamine N-acetyltransferase (AANAT), exhibit altered behaviors. We hypothesized that AANAT/melatonin system, which is up-regulated at night, affects cocaine sensitization in mice. Intraperitoneal cocaine treatment (10 and 20 mg/kg) dose-dependently increased locomotor activity of both normal (C3H/HeJ) and AANAT mutant (C57BL/6J) mice; this effect was similar during the day and at night. Injections of cocaine during the day for three days resulted in behavioral sensitization in normal and AANAT mutant mice whereas treatment at night triggered sensitization in AANAT-deficient mice only. AANAT expression and synthesis of N-acetylserotonin/melatonin could play a role in addictive properties of cocaine.
Arylamine N-acetyltransferases (NATs) are important in susceptibility to xenobiotic-induced disorders (e.g., drug-induced autoimmune disease, bladder cancer), but their role in endogenous metabolism is yet to be elucidated. The discovery that human NAT1 acts upon p-aminobenzoylgluatamate (p-ABG) to generate p-acetamidobenzoylglutamate (p-AABG), a major urinary metabolite of folic acid, suggests that human NAT1 may play a role in folic acid metabolism and hence in the normal development of the neural tube. In this study we examined the distribution of NAT in neuronal tissue from adult mice and embryos. Immunohistochemical staining of the adult mouse cerebellum revealed NAT2 (the mouse homologue of human NAT1) expression in the cell bodies and dendrites of Purkinje cells and in the neuroglia of the molecular layer. In embryos, NAT2 was detected in developing neuronal tissue on days 9.5, 11.5, and 13.5. It was expressed intensely in the nerual tube around the time of closure. The level of expression subsequently declined in the neuroepithelium but increased in glial cells. In addition, NAT2 was detected in the developing heart and gut. These findings demonstrate that the embryo itself expresses an enzyme which is involved in the metabolism of folic acid, so that the role played by both mother and embryo must be considered when examining the role of folic acid in embryonic development. These findings imply that polymorphisms in NAT genes could play a role in determining susceptibility to neural tube defects (NTD) and orofacial clefting, developmental disorders which can be prevented by dietary administration of folic acid.
The primary structure of serotonin N-acetyltransferase (arylalkylamine N-acetyltransferase, AA-NAT: the rate-limiting enzyme in melatonin synthesis) in the mouse retina was deduced from the cDNA nucleotide sequence. The deduced protein consisted of 205 amino-acid residues with sequences highly conserved in AA-NATs of vertebrates, and was 96% identical to rat AA-NAT. Northern blot analysis of mouse retinal mRNA showed two obvious bands, of 1.5 kb and 4.5 kb in length. The levels of both transcripts were low at day and high at night, but the night-to-day ratios were <2. These findings suggest that the expression mechanism of AA-NAT transcripts in the mouse retina may be different from those in other mammals, where a single transcript of AA-NAT is normally observed in Northern blots.
Pineal melatonin synthesis (serotonin --> N-acetylserotonin --> melatonin) is severely compromised in most inbred strains of mice, in many cases because serotonin is not acetylated by serotonin N-acetyltransferase (arylalkylamine N-acetyltransferase, AANAT). We have found that in the C57BL/6J strain, AANAT mRNA encodes a severely truncated AANAT protein, because a pseudo-exon containing a stop codon is spliced in. This is the first identification of a natural mutation which knocks down melatonin synthesis. The decrease in melatonin signaling may have been a selective factor in the development of laboratory strains of mice because melatonin can inhibit reproduction and modify circadian rhythmicity.
Pineal melatonin is produced during the night. Its nocturnal increase regulates circadian rhythms and the photoperiodic reproductive response. Serotonin is acetylated to N-acetylserotonin by serotonin N-acetyltransferase (SNAT) and then methylated to form melatonin by hydroxyindole-O-methyltransferase (HIOMT). The rhythmicity of melatonin synthesis is regulated by the rhythmic activity of SNAT. Most laboratory mice do not have melatonin because of a genetic defect in the activity of SNAT and/or HIOMT. In a previous study using a recombinant inbred strain, we have found that the locus controlling pineal SNAT activity (Nat4) is located on mouse Chromosome 11. Recently, SNAT has been cloned in the rat. In the present study, the gene encoding SNAT was localized, using a rat cDNA fragment, on rat and mouse chromosomes by direct R-banding fluorescence in situ hybridization (FISH). In addition, using molecular linkage analysis with interspecific backcross mice, a gene encoding SNAT was mapped on a mouse chromosome. The gene encoding SNAT was localized to rat chromosome 10q32.3 and mouse Chromosome 11E2 by FISH. The molecular linkage analysis demonstrated that the gene encoding SNAT maps 1.5 cM distal to D11Mit11. The data suggest that Nat4 encodes SNAT. These chromosomal locations are in a region of conserved linkage homology between the two species.
Melatonin is synthesized from serotonin by the enzymes serotonin N-acetyltransferase (SNAT) and hydroxyindole-O-methyl-transferase (HIOMT). We have previously reported that C57BL/6 mice do not have SNAT activity because of a mutation in an autosomal gene which is responsible for the absence of normal SNAT activity. In the present study, we have tried to map the loci of Nat-2 (the locus controlling SNAT activity) on chromosomes using a set of the BxH recombinant inbred strains which were derived from an initial cross between C3H/He with SNAT and C57BL/6 without the enzyme. Based on strain distribution patterns (SDPs), a close linkage on chromosome 11 was found between Nat-2, Es-3 (esterase-3), Glk (the locus controlling galactokinase activity) and Myla (myosin alkali light chains expressed in cardiac atrial muscle). The linkage between Nat-2 and Es-3 was confirmed by a conventional linkage test and the recombination frequency between these loci was estimated to be 16.1 +/- 3.6% (mean +/- S.E.M.).
Three genes encoding arylamine N-acetyltransferase were identified in Balb/c mice. All three genes were cloned from genomic DNA, sequenced and expressed in a bacterial expression system. Two of the genes corresponded to Nat-1 and Nat-2 which have been previously identified in A/J and C57B1/6 strains of mice (Martell et al., 1991). The new gene, designated Nat-3, can be distinguished from the other mouse Nat genes both by specific amplification using PCR and by restriction-endonuclease digestion. The products of all three genes are demonstrated to catalyse acetylation of aminofluorene and anisidine following expression in Escherichia coli.
Pineal melatonin may play an important role in regulation of vertebrate circadian rhythms and in human affective disorders. In some mammals, such as hamsters and sheep, melatonin is involved in photoperiodic time measurement and in control of reproduction. Although wild mice (Mus domesticus) and some wild-derived inbred strains of mice have melatonin in their pineal glands, several inbred strains of laboratory mice (for example, C57BL/6J) were found not to have detectable melatonin in their pineal glands. Genetic analysis suggests that melatonin deficiency in C57BL/6J mice results from mutations in two independently segregating, autosomal recessive genes. Synthesis of melatonin from serotonin in the pineal gland requires the enzymes N-acetyltransferase (NAT) and hydroxyindole-O-methyltransferase (HIOMT). Pineal glands from C57BL/6J mice have neither NAT nor HIOMT activity. These results suggest that the two genes involved in melatonin deficiency are responsible for the absence of normal NAT and HIOMT enzyme activity.