Aanat | GeneID:11298 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 11298 Official Symbol Aanat
Locus RP23-313J14.2 Gene Type protein-coding
Synonyms MGC151344; Nat-2; Nat4; SNAT
Full Name arylalkylamine N-acetyltransferase
Description arylalkylamine N-acetyltransferase
Chromosome 11 E2|11 70.0 cM
Also Known As OTTMUSP00000004270
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31013

ID Symbol Protein Species
GeneID:15 AANAT NP_001079.1 Homo sapiens
GeneID:11298 Aanat NP_033721.1 Mus musculus
GeneID:25120 Aanat NP_036950.1 Rattus norvegicus
GeneID:281583 AANAT NP_803475.1 Bos taurus
GeneID:393677 aanat1 NP_956998.1 Danio rerio
GeneID:396066 AANAT NP_990489.1 Gallus gallus
GeneID:483331 AANAT XP_540450.1 Canis lupus familiaris
GeneID:503504 AANAT NP_001012442.1 Pan troglodytes
GeneID:618594 AANAT XP_876019.2 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 acris SP5276CP Serotonin acetylase Control Peptide; antibody Ab/CP
2 acris SP5277CP Serotonin acetylase pThr29, Control Peptide; antibody Ab/CP
3 acris SP5276P Serotonin acetylase; antibody Ab
4 acris SP5277P Serotonin acetylase pThr29; antibody Ab
5 sigma S0564 Anti-Serotonin N-Acetyltransferase (N-Terminal) antibody produced in rabbit ;
6 sigma S0689 Anti-Serotonin N-Acetyltransferase (C-Terminal) antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0008415 Function acyltransferase activity
GO:0004059 Function aralkylamine N-acetyltransferase activity
GO:0004060 Function arylamine N-acetyltransferase activity
GO:0008080 Function N-acetyltransferase activity
GO:0005184 Function neuropeptide hormone activity
GO:0016740 Function transferase activity
GO:0030187 Process melatonin biosynthetic process
GO:0008152 Process metabolic process
GO:0048511 Process rhythmic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_009591  UCSC Browser NP_033721 O88816   Q14A64  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000021160 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENSMUST00000021160 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENSMUST00000021160 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSMUST00000021160 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSMUST00000021160 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENSMUST00000021160 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSMUST00000021160 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENSMUST00000021160 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSMUST00000021160 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENSMUST00000021160 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENSMUST00000021160 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSMUST00000021160 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENSMUST00000021160 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSMUST00000021160 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSMUST00000021160 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSMUST00000021160 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSMUST00000021160 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENSMUST00000021160 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENSMUST00000021160 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENSMUST00000021160 MI0000585 mmu-miR-129-3p AAGCCCUUACCCCAAAAAGCAU
ENSMUST00000021160 MI0000693 mmu-miR-139-3p UGGAGACGCGGCCCUGUUGGAG
ENSMUST00000021160 MI0000171 mmu-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENSMUST00000021160 MI0000175 mmu-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSMUST00000021160 MI0000233 mmu-miR-191* GCUGCACUUGGAUUUCGUUCCC
ENSMUST00000021160 MI0000241 mmu-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENSMUST00000021160 MI0000713 mmu-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENSMUST00000021160 MI0000714 mmu-miR-199b* CCCAGUGUUUAGACUACCUGUUC
ENSMUST00000021160 MI0000248 mmu-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSMUST00000021160 MI0000568 mmu-miR-20a* ACUGCAUUACGAGCACUUAAAG
ENSMUST00000021160 MI0000731 mmu-miR-217 UACUGCAUCAGGAACUGACUGGA
ENSMUST00000021160 MI0000711 mmu-miR-224 UAAGUCACUAGUGGUUCCGUU
ENSMUST00000021160 MI0000689 mmu-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSMUST00000021160 MI0000575 mmu-miR-26b* CCUGUUCUCCAUUACUUGGCUC
ENSMUST00000021160 MI0000398 mmu-miR-298 GGCAGAGGAGGGCUGUUCUUCCC
ENSMUST00000021160 MI0000400 mmu-miR-300* UUGAAGAGAGGUUAUCCUUUGU
ENSMUST00000021160 MI0000144 mmu-miR-30a UGUAAACAUCCUCGACUGGAAG
ENSMUST00000021160 MI0000145 mmu-miR-30b UGUAAACAUCCUACACUCAGCU
ENSMUST00000021160 MI0000549 mmu-miR-30d UGUAAACAUCCCCGACUGGAAG
ENSMUST00000021160 MI0000579 mmu-miR-31 AGGCAAGAUGCUGGCAUAGCUG
ENSMUST00000021160 MI0000603 mmu-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSMUST00000021160 MI0000607 mmu-miR-330 UCUCUGGGCCUGUGUCUUAGGC
ENSMUST00000021160 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENSMUST00000021160 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENSMUST00000021160 MI0003531 mmu-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENSMUST00000021160 MI0003537 mmu-miR-450a-3p AUUGGGGAUGCUUUGCAUUCAU
ENSMUST00000021160 MI0004705 mmu-miR-450b-3p AUUGGGAACAUUUUGCAUGCAU
ENSMUST00000021160 MI0005497 mmu-miR-453 AGGUUGCCUCAUAGUGAGCUUGCA
ENSMUST00000021160 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENSMUST00000021160 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSMUST00000021160 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENSMUST00000021160 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENSMUST00000021160 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENSMUST00000021160 MI0005516 mmu-miR-509-5p UACUCCAGAAUGUGGCAAUCAU
ENSMUST00000021160 MI0005554 mmu-miR-511 AUGCCUUUUGCUCUGCACUCA
ENSMUST00000021160 MI0003206 mmu-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENSMUST00000021160 MI0004171 mmu-miR-665 ACCAGGAGGCUGAGGUCCCU
ENSMUST00000021160 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSMUST00000021160 MI0004133 mmu-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENSMUST00000021160 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENSMUST00000021160 MI0004123 mmu-miR-675-5p UGGUGCGGAAAGGGCCCACAGU
ENSMUST00000021160 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSMUST00000021160 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENSMUST00000021160 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSMUST00000021160 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSMUST00000021160 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSMUST00000021160 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENSMUST00000021160 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENSMUST00000021160 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSMUST00000021160 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU
ENSMUST00000021160 MI0004203 mmu-miR-770-3p CGUGGGCCUGACGUGGAGCUGG
ENSMUST00000021160 MI0005551 mmu-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENSMUST00000021160 MI0005553 mmu-miR-877 GUAGAGGAGAUGGCGCAGGG
ENSMUST00000021160 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA
ENSMUST00000021160 MI0000581 mmu-miR-93* ACUGCUGAGCUAGCACUUCCCG
ENSMUST00000021160 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAD08637   AAD09408   AAD09409   AAD09410   AAD09411   AAI16968   AAI19140   AAN37495   BAA31526   CAM20509   EDL34585   NP_033721   O88816   Q14A64   Q7TNH7   Q9QUP1   Q9Z2W3  

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Klein DC, et al. (2007) "Arylalkylamine N-acetyltransferase: "the Timezyme"." J Biol Chem. 282(7):4233-4237. PMID:17164235
  2. [ + ] Simonneaux V, et al. (2006) "Rat and Syrian hamster: two models for the regulation of AANAT gene expression." Chronobiol Int. 23(1-2):351-359. PMID:16687308
  3. [ + ] Slominski A, et al. (2003) "Characterization of the serotoninergic system in the C57BL/6 mouse skin." Eur J Biochem. 270(16):3335-3344. PMID:12899690
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Uz T, et al. (2002) "Circadian differences in behavioral sensitization to cocaine: putative role of arylalkylamine N-acetyltransferase." Life Sci. 70(25):3069-3075. PMID:12138020
  6. [ + ] Stanley LA, et al. (1998) "Immunochemical detection of arylamine N-acetyltransferase during mouse embryonic development and in adult mouse brain." Teratology. 58(5):174-182. PMID:9839355
  7. [ + ] Sakamoto K, et al. (1998) "Molecular cloning of serotonin N-acetyltransferase gene from the mouse and its daily expression in the retina." Neurosci Lett. 250(3):181-184. PMID:9708862
  8. [ + ] Roseboom PH, et al. (1998) "Natural melatonin 'knockdown' in C57BL/6J mice: rare mechanism truncates serotonin N-acetyltransferase." Brain Res Mol Brain Res. 63(1):189-197. PMID:9838107
  9. [ + ] Yoshimura T, et al. (1997) "Chromosomal mapping of the gene encoding serotonin N-acetyltransferase to rat chromosome 10q32.3 and mouse chromosome 11E2." Cytogenet Cell Genet. 79(3-4):172-175. PMID:9605843
  10. [ + ] Goto M, et al. (1994) "The locus controlling pineal serotonin N-acetyltransferase activity (Nat-2) is located on mouse chromosome 11." Brain Res Mol Brain Res. 21(3-4):349-354. PMID:8170356
  11. [ + ] Kelly SL, et al. (1994) "Arylamine N-acetyltransferase in Balb/c mice: identification of a novel mouse isoenzyme by cloning and expression in vitro." Biochem J. 302 ( Pt 2)():347-353. PMID:7545952
  12. [ + ] Ebihara S, et al. (1986) "Genetic control of melatonin synthesis in the pineal gland of the mouse." Science. 231(4737):491-493. PMID:3941912