ABCB8 | GeneID:11194 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 11194 Official Symbol ABCB8
Locus N/A Gene Type protein-coding
Synonyms EST328128; M-ABC1; MABC1
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 8
Description ATP-binding cassette, sub-family B (MDR/TAP), member 8
Chromosome 7q36
Also Known As ATP-binding cassette, sub-family B, member 8; mitochondrial ABC protein
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. The function of this half-transporter has not yet been determined; however, it may involve the compartmentalization and transport of heme, as well as peptides, from the mitochondria to the nucleus and cytosol. This protein may also play a role in the transport of phospholipids into mitochondrial membranes. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5203

ID Symbol Protein Species
GeneID:11194 ABCB8 NP_009119.2 Homo sapiens
GeneID:32208 CG1824 NP_572810.1 Drosophila melanogaster
GeneID:74610 Abcb8 NP_083296.2 Mus musculus
GeneID:171694 haf-6 NP_490828.3 Caenorhabditis elegans
GeneID:362302 Abcb8 NP_001007797.1 Rattus norvegicus
GeneID:463892 ABCB8 XP_519524.2 Pan troglodytes
GeneID:482800 ABCB8 XP_539916.2 Canis lupus familiaris
GeneID:548340 zgc:113037 NP_001017544.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abgent AP6129a ABCB8 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
2 acris AP13092PU-N ABCB8 (N-term); antibody Ab

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCB8 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCB8 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0043190 Component ATP-binding cassette (ABC) transporter complex
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0005740 Component mitochondrial envelope
GO:0005743 Component mitochondrial inner membrane
GO:0005739 Component mitochondrion
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005215 Function transporter activity
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_007188  UCSC Browser NP_009119

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000358849 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000358849 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000358849 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000358849 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000358849 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000358849 MI0000434 hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENST00000358849 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENST00000358849 MI0000478 hsa-miR-149* AGGGAGGGACGGGGGCUGUGC
ENST00000358849 MI0001518 hsa-miR-18b* UGCCCUAAAUGCCCCUUCUGGC
ENST00000358849 MI0000737 hsa-miR-200a UAACACUGUCUGGUAACGAUGU
ENST00000358849 MI0000342 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENST00000358849 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000358849 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000358849 MI0000085 hsa-miR-27a* AGGGCUUAGCUGCUUGUGAGCA
ENST00000358849 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENST00000358849 MI0000824 hsa-miR-325 CCUAGUAGGUGUCCAGUAAGUGU
ENST00000358849 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENST00000358849 MI0000760 hsa-miR-361-3p UCCCCCAGGUGUGAUUCUGAUUU
ENST00000358849 MI0001445 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENST00000358849 MI0002468 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENST00000358849 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000358849 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000358849 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000358849 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000358849 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000358849 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENST00000358849 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENST00000358849 MI0003643 hsa-miR-629* GUUCUCCCAACGUAAGCCCAGC
ENST00000358849 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENST00000358849 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENST00000358849 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENST00000358849 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENST00000358849 MI0000100 hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENST00000358849 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000358849 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENST00000358849 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENST00000358849 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENST00000358849 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
pirinixic acid
  • pirinixic acid results in increased expression of ABCB8 mRNA
18301758

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
SAT SAT / ABCB8 Two-hybrid Stelzl U (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Tang L, et al. (2009) "Exclusion of ABCB8 and ABCB10 as cancer candidate genes in acute myeloid leukemia." Leukemia. 23(5):1000-1002. PMID:19151771
  3. [ + ] Elliott AM, et al. (2009) "ABCB8 mediates doxorubicin resistance in melanoma cells by protecting the mitochondrial genome." Mol Cancer Res. 7(1):79-87. PMID:19147539
  4. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  5. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  6. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  8. [ + ] Saito S, et al. (2002) "Three hundred twenty-six genetic variations in genes encoding nine members of ATP-binding cassette, subfamily B (ABCB/MDR/TAP), in the Japanese population." J Hum Genet. 47(1):38-50. PMID:11829140
  9. [ + ] Hogue DL, et al. (1999) "Identification and characterization of a mammalian mitochondrial ATP-binding cassette membrane protein." J Mol Biol. 285(1):379-389. PMID:9878413
  10. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  11. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702
  12. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298