ABHD2 | GeneID:11057 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 11057 Official Symbol ABHD2
Locus N/A Gene Type protein-coding
Synonyms HS1-2; LABH2; MGC111112; MGC26249; PHPS1-2
Full Name abhydrolase domain containing 2
Description abhydrolase domain containing 2
Chromosome 15q26.1
Also Known As alpha/beta hydrolase domain containing protein 2; lung alpha/beta hydrolase 2
Summary This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. The function of this protein has not been determined. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23121

ID Symbol Protein Species
GeneID:11057 ABHD2 NP_008942.3 Homo sapiens
GeneID:33532 CG3488 NP_608751.2 Drosophila melanogaster
GeneID:54608 Abhd2 NP_061281.3 Mus musculus
GeneID:293050 Abhd2 XP_214979.2 Rattus norvegicus
GeneID:393888 abhd2a NP_957208.1 Danio rerio
GeneID:415493 ABHD2 XP_413866.2 Gallus gallus
GeneID:467753 ABHD2 XP_523148.2 Pan troglodytes
GeneID:479037 ABHD2 XP_849732.1 Canis lupus familiaris
GeneID:508717 ABHD2 NP_001015549.1 Bos taurus
GeneID:559290 abhd2b NP_001073145.1 Danio rerio
GeneID:1277482 ENSANGG00000004955 XP_316894.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma HPA005999 Anti-ABHD2 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABHD2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABHD2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity
GO:0003674 Function molecular_function
GO:0008150 Process biological_process
GO:0030336 Process negative regulation of cell migration
GO:0009611 Process response to wounding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_007011  UCSC Browser NP_008942
2 NM_152924  UCSC Browser NP_690888

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000352732 MI0000456 hsa-miR-140-3p UACCACAGGGUAGAACCACGG
ENST00000352732 MI0000083 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000352732 MI0000750 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000352732 MI0000084 hsa-miR-26b UUCAAGUAAUUCAGGAUAGGU
ENST00000352732 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENST00000352732 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000352732 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000352732 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000352732 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENST00000352732 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENST00000352732 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000352732 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000352732 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000352732 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000352732 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000352732 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENST00000352732 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENST00000355100 MI0000066 hsa-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENST00000355100 MI0000068 hsa-let-7f-2* CUAUACAGUCUACUGUCUUUCC
ENST00000355100 MI0000433 hsa-let-7g* CUGUACAGGCCACUGCCUUGC
ENST00000355100 MI0000734 hsa-miR-106b* CCGCACUGUGGGUACUUGCUGC
ENST00000355100 MI0000266 hsa-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENST00000355100 MI0000266 hsa-miR-10a* CAAAUUCGUAUCUAGGGGAAUA
ENST00000355100 MI0000267 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENST00000355100 MI0000809 hsa-miR-151-5p UCGAGGAGCUCACAGUCUAGU
ENST00000355100 MI0000480 hsa-miR-154* AAUCAUACACGGUUGACCUAUU
ENST00000355100 MI0000483 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENST00000355100 MI0000737 hsa-miR-200a* CAUCUUACCGGACAGUGCUGGA
ENST00000355100 MI0000286 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA
ENST00000355100 MI0000740 hsa-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU
ENST00000355100 MI0000088 hsa-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENST00000355100 MI0000441 hsa-miR-30b* CUGGGAGGUGGAUGUUUACUUC
ENST00000355100 MI0000255 hsa-miR-30d* CUUUCAGUCAGAUGUUUGCUGC
ENST00000355100 MI0000749 hsa-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENST00000355100 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENST00000355100 MI0000743 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG
ENST00000355100 MI0000760 hsa-miR-361-5p UUAUCAGAAUCUCCAGGGGUAC
ENST00000355100 MI0000782 hsa-miR-374a* CUUAUCAGAUUGUAUUGUAAUU
ENST00000355100 MI0005566 hsa-miR-374b* CUUAGCAGGUUGUAUUAUCAUU
ENST00000355100 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENST00000355100 MI0001733 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA
ENST00000355100 MI0001733 hsa-miR-452* CUCAUCUGCAAAGAAGUAAGUG
ENST00000355100 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENST00000355100 MI0003126 hsa-miR-491-3p CUUAUGCAAGAUUCCCUUCUAC
ENST00000355100 MI0003126 hsa-miR-491-5p AGUGGGGAACCCUUCCAUGAGG
ENST00000355100 MI0003135 hsa-miR-495 AAACAAACAUGGUGCACUUCUU
ENST00000355100 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENST00000355100 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENST00000355100 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENST00000355100 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENST00000355100 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENST00000355100 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENST00000355100 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENST00000355100 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENST00000355100 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENST00000355100 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000355100 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENST00000355100 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000355100 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000355100 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000355100 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000355100 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000355100 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENST00000355100 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000355100 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000355100 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENST00000355100 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.720G>A1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABHD2 mRNA
17562736
Dietary Carbohydrates
  • Dietary Carbohydrates results in decreased expression of ABHD2 mRNA
17490981
Ketone Bodies
  • Ketone Bodies results in decreased expression of ABHD2 mRNA
16807920
pirinixic acid
  • pirinixic acid results in increased expression of ABHD2 mRNA
18301758
testosterone enanthate
  • testosterone enanthate affects the expression of ABHD2 mRNA
17440010

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
HIV Wasting Syndrome inferred via testosterone enanthate 17440010
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16177239, 15968718, 16227642, 14986274, 16081117, 17522070, 17562736
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  2. [ + ] Miyata K, et al. (2008) "Elevated mature macrophage expression of human ABHD2 gene in vulnerable plaque." Biochem Biophys Res Commun. 365(2):207-213. PMID:17980156
  3. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  4. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  5. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  6. [ + ] Edgar AJ, et al. (2002) "Cloning and tissue distribution of three murine alpha/beta hydrolase fold protein cDNAs." Biochem Biophys Res Commun. 292(3):617-625. PMID:11922611
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  8. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  9. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298
  10. [ + ] Rapiejko PJ, et al. (1988) "Primary structure of a human protein which bears structural similarities to members of the rhodopsin/beta-adrenergic receptor family." Nucleic Acids Res. 16(17):8721. PMID:2843827