ABHD2 | GeneID:11057 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 11057 | Official Symbol | ABHD2 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | HS1-2; LABH2; MGC111112; MGC26249; PHPS1-2 | ||
| Full Name | abhydrolase domain containing 2 | ||
| Description | abhydrolase domain containing 2 | ||
| Chromosome | 15q26.1 | ||
| Also Known As | alpha/beta hydrolase domain containing protein 2; lung alpha/beta hydrolase 2 | ||
| Summary | This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. The function of this protein has not been determined. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 23121
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:11057 | ABHD2 | NP_008942.3 | Homo sapiens |
| GeneID:33532 | CG3488 | NP_608751.2 | Drosophila melanogaster |
| GeneID:54608 | Abhd2 | NP_061281.3 | Mus musculus |
| GeneID:293050 | Abhd2 | XP_214979.2 | Rattus norvegicus |
| GeneID:393888 | abhd2a | NP_957208.1 | Danio rerio |
| GeneID:415493 | ABHD2 | XP_413866.2 | Gallus gallus |
| GeneID:467753 | ABHD2 | XP_523148.2 | Pan troglodytes |
| GeneID:479037 | ABHD2 | XP_849732.1 | Canis lupus familiaris |
| GeneID:508717 | ABHD2 | NP_001015549.1 | Bos taurus |
| GeneID:559290 | abhd2b | NP_001073145.1 | Danio rerio |
| GeneID:1277482 | ENSANGG00000004955 | XP_316894.2 | Anopheles gambiae |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | sigma | HPA005999 | Anti-ABHD2 antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0016021 | Component | integral to membrane |
| GO:0016020 | Component | membrane |
| GO:0005730 | Component | nucleolus |
| GO:0005634 | Component | nucleus |
| GO:0004091 | Function | carboxylesterase activity |
| GO:0016787 | Function | hydrolase activity |
| GO:0003674 | Function | molecular_function |
| GO:0008150 | Process | biological_process |
| GO:0030336 | Process | negative regulation of cell migration |
| GO:0009611 | Process | response to wounding |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000352732 | MI0000456 | hsa-miR-140-3p | UACCACAGGGUAGAACCACGG |
| ENST00000352732 | MI0000083 | hsa-miR-26a | UUCAAGUAAUCCAGGAUAGGCU |
| ENST00000352732 | MI0000750 | hsa-miR-26a | UUCAAGUAAUCCAGGAUAGGCU |
| ENST00000352732 | MI0000084 | hsa-miR-26b | UUCAAGUAAUUCAGGAUAGGU |
| ENST00000352732 | MI0003131 | hsa-miR-492 | AGGACCUGCGGGACAAGAUUCUU |
| ENST00000352732 | MI0003178 | hsa-miR-519a | AAAGUGCAUCCUUUUAGAGUGU |
| ENST00000352732 | MI0003182 | hsa-miR-519a | AAAGUGCAUCCUUUUAGAGUGU |
| ENST00000352732 | MI0003148 | hsa-miR-519c-3p | AAAGUGCAUCUUUUUAGAGGAU |
| ENST00000352732 | MI0003618 | hsa-miR-605 | UAAAUCCCAUGGUGCCUUCUCCU |
| ENST00000352732 | MI0000388 | mmu-miR-290-3p | AAAGUGCCGCCUAGUUUUAAGCCC |
| ENST00000352732 | MI0002401 | mmu-miR-466a-3p | UAUACAUACACGCACACAUAAGA |
| ENST00000352732 | MI0005504 | mmu-miR-466b-3-3p | AAUACAUACACGCACACAUAAGA |
| ENST00000352732 | MI0005507 | mmu-miR-466f-3p | CAUACACACACACAUACACAC |
| ENST00000352732 | MI0005508 | mmu-miR-466f-3p | CAUACACACACACAUACACAC |
| ENST00000352732 | MI0005509 | mmu-miR-466f-3p | CAUACACACACACAUACACAC |
| ENST00000352732 | MI0002402 | mmu-miR-467a | UAAGUGCCUGCAUGUAUAUGCG |
| ENST00000352732 | MI0004651 | mmu-miR-719 | AUCUCGGCUACAGAAAAAUGUU |
| ENST00000355100 | MI0000066 | hsa-let-7e* | CUAUACGGCCUCCUAGCUUUCC |
| ENST00000355100 | MI0000068 | hsa-let-7f-2* | CUAUACAGUCUACUGUCUUUCC |
| ENST00000355100 | MI0000433 | hsa-let-7g* | CUGUACAGGCCACUGCCUUGC |
| ENST00000355100 | MI0000734 | hsa-miR-106b* | CCGCACUGUGGGUACUUGCUGC |
| ENST00000355100 | MI0000266 | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
| ENST00000355100 | MI0000266 | hsa-miR-10a* | CAAAUUCGUAUCUAGGGGAAUA |
| ENST00000355100 | MI0000267 | hsa-miR-10b | UACCCUGUAGAACCGAAUUUGUG |
| ENST00000355100 | MI0000809 | hsa-miR-151-5p | UCGAGGAGCUCACAGUCUAGU |
| ENST00000355100 | MI0000480 | hsa-miR-154* | AAUCAUACACGGUUGACCUAUU |
| ENST00000355100 | MI0000483 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCU |
| ENST00000355100 | MI0000737 | hsa-miR-200a* | CAUCUUACCGGACAGUGCUGGA |
| ENST00000355100 | MI0000286 | hsa-miR-210 | CUGUGCGUGUGACAGCGGCUGA |
| ENST00000355100 | MI0000740 | hsa-miR-219-2-3p | AGAAUUGUGGCUGGACAUCUGU |
| ENST00000355100 | MI0000088 | hsa-miR-30a* | CUUUCAGUCGGAUGUUUGCAGC |
| ENST00000355100 | MI0000441 | hsa-miR-30b* | CUGGGAGGUGGAUGUUUACUUC |
| ENST00000355100 | MI0000255 | hsa-miR-30d* | CUUUCAGUCAGAUGUUUGCUGC |
| ENST00000355100 | MI0000749 | hsa-miR-30e* | CUUUCAGUCGGAUGUUUACAGC |
| ENST00000355100 | MI0000815 | hsa-miR-339-3p | UGAGCGCCUCGACGACAGAGCCG |
| ENST00000355100 | MI0000743 | hsa-miR-34c-3p | AAUCACUAACCACACGGCCAGG |
| ENST00000355100 | MI0000760 | hsa-miR-361-5p | UUAUCAGAAUCUCCAGGGGUAC |
| ENST00000355100 | MI0000782 | hsa-miR-374a* | CUUAUCAGAUUGUAUUGUAAUU |
| ENST00000355100 | MI0005566 | hsa-miR-374b* | CUUAGCAGGUUGUAUUAUCAUU |
| ENST00000355100 | MI0000791 | hsa-miR-383 | AGAUCAGAAGGUGAUUGUGGCU |
| ENST00000355100 | MI0001733 | hsa-miR-452 | AACUGUUUGCAGAGGAAACUGA |
| ENST00000355100 | MI0001733 | hsa-miR-452* | CUCAUCUGCAAAGAAGUAAGUG |
| ENST00000355100 | MI0002469 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
| ENST00000355100 | MI0003126 | hsa-miR-491-3p | CUUAUGCAAGAUUCCCUUCUAC |
| ENST00000355100 | MI0003126 | hsa-miR-491-5p | AGUGGGGAACCCUUCCAUGAGG |
| ENST00000355100 | MI0003135 | hsa-miR-495 | AAACAAACAUGGUGCACUUCUU |
| ENST00000355100 | MI0003195 | hsa-miR-508-3p | UGAUUGUAGCCUUUUGGAGUAGA |
| ENST00000355100 | MI0003169 | hsa-miR-518e | AAAGCGCUUCCCUUCAGAGUG |
| ENST00000355100 | MI0003562 | hsa-miR-556-3p | AUAUUACCAUUAGCUCAUCUUU |
| ENST00000355100 | MI0003580 | hsa-miR-573 | CUGAAGUGAUGUGUAACUGAUCAG |
| ENST00000355100 | MI0003591 | hsa-miR-584 | UUAUGGUUUGCCUGGGACUGAG |
| ENST00000355100 | MI0003597 | hsa-miR-588 | UUGGCCACAAUGGGUUAGAAC |
| ENST00000355100 | MI0003640 | hsa-miR-626 | AGCUGUCUGAAAAUGUCUU |
| ENST00000355100 | MI0003651 | hsa-miR-636 | UGUGCUUGCUCGUCCCGCCCGCA |
| ENST00000355100 | MI0003659 | hsa-miR-644 | AGUGUGGCUUUCUUAGAGC |
| ENST00000355100 | MI0003662 | hsa-miR-647 | GUGGCUGCACUCACUUCCUUC |
| ENST00000355100 | MI0005538 | hsa-miR-892b | CACUGGCUCCUUUCUGGGUAGA |
| ENST00000355100 | MI0002401 | mmu-miR-466a-5p | UAUGUGUGUGUACAUGUACAUA |
| ENST00000355100 | MI0005502 | mmu-miR-466b-5p | GAUGUGUGUGUACAUGUACAUG |
| ENST00000355100 | MI0005503 | mmu-miR-466b-5p | GAUGUGUGUGUACAUGUACAUG |
| ENST00000355100 | MI0005504 | mmu-miR-466b-5p | GAUGUGUGUGUACAUGUACAUG |
| ENST00000355100 | MI0005505 | mmu-miR-466c-5p | GAUGUGUGUGUGCAUGUACAUA |
| ENST00000355100 | MI0005546 | mmu-miR-466d-5p | UGUGUGUGCGUACAUGUACAUG |
| ENST00000355100 | MI0005506 | mmu-miR-466e-5p | GAUGUGUGUGUACAUGUACAUA |
| ENST00000355100 | MI0005511 | mmu-miR-466h | UGUGUGCAUGUGCUUGUGUGUA |
| ENST00000355100 | MI0004643 | mmu-miR-681 | CAGCCUCGCUGGCAGGCAGCU |
| ENST00000355100 | MI0004662 | mmu-miR-693-3p | GCAGCUUUCAGAUGUGGCUGUAA |
Mutations and SNPs
[
] NCBI's dbSNP
- All SNPs in GeneID:11057 / ABHD2 Gene
[
] Somatic Mutations in Cancer - Sanger's COSMIC
The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
| Mutation (top 10) | Total Observations |
|---|---|
| c.720G>A | 1 |
| Primary Site / Histology (Top 10) | Mutations (sites * observations) |
|---|---|
| lung / carcinoma | 1 |
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| Acetaminophen | |
|
|
| Dietary Carbohydrates | |
|
|
| Ketone Bodies | |
|
|
| pirinixic acid | |
|
|
| testosterone enanthate | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Disease Name | Relationship | PubMed |
|---|---|---|
| HIV Wasting Syndrome | inferred via testosterone enanthate | 17440010 |
| Edema | inferred via pirinixic acid | 12083418 |
| Liver Neoplasms | inferred via pirinixic acid | 15890375 |
| Hepatitis, Toxic | inferred via Acetaminophen | 2444490, 16177239, 15968718, 16227642, 14986274, 16081117, 17522070, 17562736 |
| Hyperalgesia | inferred via Acetaminophen | 16870215 |
| Liver Failure, Acute | inferred via Acetaminophen | 16871587, 17185352 |
| Pain | inferred via Acetaminophen | 16870215 |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348 - [
] Miyata K, et al. (2008) "Elevated mature macrophage expression of human ABHD2 gene in vulnerable plaque." Biochem Biophys Res Commun. 365(2):207-213. PMID:17980156 - [
] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560 - [
] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Edgar AJ, et al. (2002) "Cloning and tissue distribution of three murine alpha/beta hydrolase fold protein cDNAs." Biochem Biophys Res Commun. 292(3):617-625. PMID:11922611 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149 - [
] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298 - [
] Rapiejko PJ, et al. (1988) "Primary structure of a human protein which bears structural similarities to members of the rhodopsin/beta-adrenergic receptor family." Nucleic Acids Res. 16(17):8721. PMID:2843827
Information on protein localization on the subcellular level is important to map and characterize the proteome and to better understand cellular functions of proteins. Here we report on a pilot study of 466 proteins in three human cell lines aimed to allow large scale confocal microscopy analysis using protein-specific antibodies. Approximately 3000 high resolution images were generated, and more than 80% of the analyzed proteins could be classified in one or multiple subcellular compartment(s). The localizations of the proteins showed, in many cases, good agreement with the Gene Ontology localization prediction model. This is the first large scale antibody-based study to localize proteins into subcellular compartments using antibodies and confocal microscopy. The results suggest that this approach might be a valuable tool in conjunction with predictive models for protein localization.
We previously reported that the mouse alpha/beta hydrolase domain containing 2 (Abhd2) was expressed in smooth muscle cells (SMCs) which suppressed their migration and inhibited the development of intimal hyperplasia by cuff placement; however, the role of ABHD2 in human remains to be elucidated. In this study, we examined ABHD2 expression in the human coronary atherosclerotic lesions of the patients with unstable angina (UA) and stable angina (SA). Our results showed that the ABHD2 was expressed in atherosclerotic lesions, and that the ABHD2 expression was significantly higher in the patients with UA than with SA. Immunohistochemistry analysis revealed abundant expression of ABHD2 in macrophages, but low expression in SMCs of atherosclerotic lesions. Using human vascular primary culture cell lines, we also demonstrated that the expression of ABHD2 was significantly higher in macrophages than in SMCs, and that the expression of ABHD2 significantly increased proportionally with differentiation from monocyte into macrophage.
By analyzing 1,780,295 5'-end sequences of human full-length cDNAs derived from 164 kinds of oligo-cap cDNA libraries, we identified 269,774 independent positions of transcriptional start sites (TSSs) for 14,628 human RefSeq genes. These TSSs were clustered into 30,964 clusters that were separated from each other by more than 500 bp and thus are very likely to constitute mutually distinct alternative promoters. To our surprise, at least 7674 (52%) human RefSeq genes were subject to regulation by putative alternative promoters (PAPs). On average, there were 3.1 PAPs per gene, with the composition of one CpG-island-containing promoter per 2.6 CpG-less promoters. In 17% of the PAP-containing loci, tissue-specific use of the PAPs was observed. The richest tissue sources of the tissue-specific PAPs were testis and brain. It was also intriguing that the PAP-containing promoters were enriched in the genes encoding signal transduction-related proteins and were rarer in the genes encoding extracellular proteins, possibly reflecting the varied functional requirement for and the restricted expression of those categories of genes, respectively. The patterns of the first exons were highly diverse as well. On average, there were 7.7 different splicing types of first exons per locus partly produced by the PAPs, suggesting that a wide variety of transcripts can be achieved by this mechanism. Our findings suggest that use of alternate promoters and consequent alternative use of first exons should play a pivotal role in generating the complexity required for the highly elaborated molecular systems in humans.
As a base for human transcriptome and functional genomics, we created the "full-length long Japan" (FLJ) collection of sequenced human cDNAs. We determined the entire sequence of 21,243 selected clones and found that 14,490 cDNAs (10,897 clusters) were unique to the FLJ collection. About half of them (5,416) seemed to be protein-coding. Of those, 1,999 clusters had not been predicted by computational methods. The distribution of GC content of nonpredicted cDNAs had a peak at approximately 58% compared with a peak at approximately 42%for predicted cDNAs. Thus, there seems to be a slight bias against GC-rich transcripts in current gene prediction procedures. The rest of the cDNAs unique to the FLJ collection (5,481) contained no obvious open reading frames (ORFs) and thus are candidate noncoding RNAs. About one-fourth of them (1,378) showed a clear pattern of splicing. The distribution of GC content of noncoding cDNAs was narrow and had a peak at approximately 42%, relatively low compared with that of protein-coding cDNAs.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
We have cloned 3 novel murine cDNAs encoding proteins containing an alpha/beta hydrolase fold; a catalytic domain found in a very wide range of enzymes. These proteins belong to the prosite UPF0017 uncharacterized protein family and we have named them lung alpha/beta hydrolase 1, 2, and 3 (LABH) since they were cloned from lung cDNA. All have 9 coding exons, encoding 412, 425, and 411 residue proteins respectively (46-48 kDa); LABH1 being closely related to LABH3 having 45% identity. All 3 proteins have a single predicted amino-terminus transmembrane domain. An alignment of family members from different phyla enabled the identification of the LABH1 catalytic triad as Ser211, Asp337, and His366. mRNA expression levels of LABH1 and 3 were highest in liver and LABH2 highest in testis. These findings suggest that the LABH proteins consist of a novel family of membrane bound enzymes whose function has yet to be determined.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
Using 'oligo-capped' mRNA [Maruyama, K., Sugano, S., 1994. Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene 138, 171-174], whose cap structure was replaced by a synthetic oligonucleotide, we constructed two types of cDNA library. One is a 'full length-enriched cDNA library' which has a high content of full-length cDNA clones and the other is a '5'-end-enriched cDNA library', which has a high content of cDNA clones with their mRNA start sites. The 5'-end-enriched library was constructed especially for isolating the mRNA start sites of long mRNAs. In order to characterize these libraries, we performed one-pass sequencing of randomly selected cDNA clones from both libraries (84 clones for the full length-enriched cDNA library and 159 clones for the 5'-end-enriched cDNA library). The cDNA clones of the polypeptide chain elongation factor 1 alpha were most frequently (nine clones) isolated, and more than 80% of them (eight clones) contained the mRNA start site of the gene. Furthermore, about 80% of the cDNA clones of both libraries whose sequence matched with known genes had the known 5' ends or sequences upstream of the known 5' ends (28 out of 35 for the full length-enriched library and 51 out of 62 for the 5'-end-enriched library). The longest full-length clone of the full length-enriched cDNA library was about 3300 bp (among 28 clones). In contrast, seven clones (out of the 51 clones with the mRNA start sites) from the 5'-end-enriched cDNA library came from mRNAs whose length is more than 3500 bp. These cDNA libraries may be useful for generating 5' ESTs with the information of the mRNA start sites that are now scarce in the EST database.
We have devised a method to replace the cap structure of a mRNA with an oligoribonucleotide (r-oligo) to label the 5' end of eukaryotic mRNAs. The method consists of removing the cap with tobacco acid pyrophosphatase (TAP) and ligating r-oligos to decapped mRNAs with T4 RNA ligase. This reaction was made cap-specific by removing 5'-phosphates of non-capped RNAs with alkaline phosphatase prior to TAP treatment. Unlike the conventional methods that label the 5' end of cDNAs, this method specifically labels the capped end of the mRNAs with a synthetic r-oligo prior to first-strand cDNA synthesis. The 5' end of the mRNA was identified quite simply by reverse transcription-polymerase chain reaction (RT-PCR).

