ACAA2 | GeneID:10449 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 10449 Official Symbol ACAA2
Locus N/A Gene Type protein-coding
Synonyms DSAEC; FLJ35992; FLJ95265
Full Name acetyl-Coenzyme A acyltransferase 2
Description acetyl-Coenzyme A acyltransferase 2
Chromosome 18q21.1
Also Known As acetyl-coenzyme A acyltransferase 2; beta ketothiolase; mitochondrial 3-oxoacyl-CoA thiolase; mitochondrial 3-oxoacyl-Coenzyme A thiolase
Summary The encoded protein catalyzes the last step of the mitochondrial fatty acid beta-oxidation spiral. Unlike most mitochondrial matrix proteins, it contains a non-cleavable amino-terminal targeting signal. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 4456

ID Symbol Protein Species
GeneID:10449 ACAA2 NP_006102.1 Homo sapiens
GeneID:34313 yip2 NP_523528.1 Drosophila melanogaster
GeneID:52538 Acaa2 NP_803421.1 Mus musculus
GeneID:170465 Acaa2 NP_569117.1 Rattus norvegicus
GeneID:176756 Thiolases NP_499752.2 Caenorhabditis elegans
GeneID:406325 zgc:56036 NP_998217.1 Danio rerio
GeneID:426847 ACAA2 NP_001006571.1 Gallus gallus
GeneID:455414 ACAA2 XP_512127.2 Pan troglodytes
GeneID:522006 ACAA2 NP_001030419.1 Bos taurus
GeneID:1270244 AgaP_AGAP006821 XP_308924.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab58278 ACAA2 antibody (ab58278); Mouse monoclonal to ACAA2
2 abnova H00010449-M01 ACAA2 monoclonal antibody (M01), clone 5C4; Mouse monoclonal antibody raised against a partial recombinant ACAA2.
3 abnova H00010449-M05 ACAA2 monoclonal antibody (M05), clone 2F7; Mouse monoclonal antibody raised against a partial recombinant ACAA2.
4 scbt ACAA2 ACAA2 Antibody / ACAA2 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACAA2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACAA2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005743 Component mitochondrial inner membrane
GO:0005739 Component mitochondrion
GO:0003988 Function acetyl-CoA C-acyltransferase activity
GO:0008415 Function acyltransferase activity
GO:0016740 Function transferase activity
GO:0006695 Process cholesterol biosynthetic process
GO:0006631 Process fatty acid metabolic process
GO:0006629 Process lipid metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_006111  UCSC Browser NP_006102 P42765   B3KNP8  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000285093 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000285093 MI0000449 hsa-miR-132* ACCGUGGCUUUCGAUUGUUACU
ENST00000285093 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENST00000285093 MI0000477 hsa-miR-146a* CCUCUGAAAUUCAGUUCUUCAG
ENST00000285093 MI0000811 hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
ENST00000285093 MI0000479 hsa-miR-150* CUGGUACAGGCCUGGGGGACAG
ENST00000285093 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENST00000285093 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENST00000285093 MI0000732 hsa-miR-194* CCAGUGGGGCUGCUGUUAUCUG
ENST00000285093 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENST00000285093 MI0000439 hsa-miR-23b* UGGGUUCCUGGCAUGCUGAUUU
ENST00000285093 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000285093 MI0000083 hsa-miR-26a-1* CCUAUUCUUGGUUACUUGCACG
ENST00000285093 MI0000750 hsa-miR-26a-2* CCUAUUCUUGAUUACUUGUUUC
ENST00000285093 MI0000084 hsa-miR-26b UUCAAGUAAUUCAGGAUAGGU
ENST00000285093 MI0000084 hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC
ENST00000285093 MI0000085 hsa-miR-27a UUCACAGUGGCUAAGUUCCGC
ENST00000285093 MI0000440 hsa-miR-27b UUCACAGUGGCUAAGUUCUGC
ENST00000285093 MI0005523 hsa-miR-298 AGCAGAAGCAGGGAGGUUCUCCCA
ENST00000285093 MI0000087 hsa-miR-29a* ACUGAUUUCUUUUGGUGUUCAG
ENST00000285093 MI0000268 hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENST00000285093 MI0000742 hsa-miR-34b CAAUCACUAACUCCACUGCCAU
ENST00000285093 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENST00000285093 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000285093 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000285093 MI0001733 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA
ENST00000285093 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENST00000285093 MI0003190 hsa-miR-505 CGUCAACACUUGCUGGUUUCCU
ENST00000285093 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENST00000285093 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENST00000285093 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000285093 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000285093 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000285093 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENST00000285093 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000285093 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENST00000285093 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENST00000285093 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENST00000285093 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENST00000285093 MI0003610 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA
ENST00000285093 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENST00000285093 MI0003620 hsa-miR-607 GUUCAAAUCCAGAUCUAUAAC
ENST00000285093 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENST00000285093 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENST00000285093 MI0003678 hsa-miR-656 AAUAUUAUACAGUCAACCUCU
ENST00000285093 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000285093 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENST00000285093 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENST00000285093 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENST00000285093 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENST00000285093 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENST00000285093 MI0000093 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000285093 MI0000094 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000285093 MI0003560 hsa-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENST00000285093 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENST00000285093 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000285093 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENST00000285093 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENST00000285093 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
2-Acetylaminofluorene
  • [Diethylnitrosamine co-treated with 2-Acetylaminofluorene] results in increased expression of ACAA2 mRNA
14656948
3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid
  • 3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid results in decreased expression of ACAA2 mRNA
16788091
Acetaminophen
  • Acetaminophen affects the expression of ACAA2 mRNA
17562736
AGN 194204
  • AGN 194204 results in increased expression of ACAA2 mRNA
16339527
alpha-hexachlorocyclohexane
  • alpha-hexachlorocyclohexane results in decreased expression of ACAA2 mRNA
16940010
arsenic trioxide
  • arsenic trioxide results in increased expression of ACAA2 mRNA
15761015
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ACAA2 mRNA
17484886
Carbon Tetrachloride
  • Carbon Tetrachloride affects the expression of ACAA2 mRNA
15963342
Clofibrate
  • Clofibrate results in increased expression of ACAA2 mRNA
12011481
Clofibric Acid
  • Clofibric Acid affects the expression of ACAA2 mRNA
17602206
coumarin
  • coumarin affects the expression of ACAA2 mRNA
16963487
Dietary Fats
  • Dietary Fats results in increased expression of ACAA2 mRNA
18042831
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with 2-Acetylaminofluorene] results in increased expression of ACAA2 mRNA
14656948
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ACAA2 mRNA
17108234
Gemfibrozil
  • Gemfibrozil affects the expression of ACAA2 mRNA
12011481
nitrosobenzylmethylamine
  • nitrosobenzylmethylamine results in decreased expression of ACAA2 mRNA
17616710
palm oil
  • palm oil results in increased expression of ACAA2 mRNA
18042831
Phenobarbital
  • Phenobarbital results in decreased expression of ACAA2 mRNA
12011481
pirinixic acid
  • pirinixic acid results in increased expression of ACAA2 mRNA
16940010, 12011481
pirinixic acid
  • pirinixic acid results in increased expression of ACAA2 mRNA
18301758, 17426115
Ro 65-7199
  • Ro 65-7199 affects the expression of ACAA2 mRNA
14610520
Ro 66-0074
  • Ro 66-0074 affects the expression of ACAA2 mRNA
14610520
Tretinoin
  • Tretinoin results in decreased expression of ACAA2 mRNA
16788091
Tunicamycin
  • Tunicamycin results in decreased expression of ACAA2 mRNA
17127020

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 15748426, 16788101, 16766008, 17506722, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17217047, 17107899, 16935935, 12679006, 16823087
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Dystonia inferred via Phenobarbital 1851702
Epilepsy, Absence inferred via Phenobarbital 6401628
Liver Neoplasms inferred via Phenobarbital 15975961, 8742319
Myoclonic Epilepsies, Progressive inferred via Phenobarbital 17484760
Osteomalacia inferred via Phenobarbital 17016548
Pancreatic Neoplasms inferred via Phenobarbital 16965848
Pseudolymphoma inferred via Phenobarbital 12752131
Seizures, Febrile inferred via Phenobarbital 6407741
Esophageal Neoplasms inferred via nitrosobenzylmethylamine 16805852, 15878914, 15547721, 15623463, 15150132, 15264214, 15547733, 16510608, 16704527
Stomach Neoplasms inferred via nitrosobenzylmethylamine 17575124, 12958204
Dyslipidemias inferred via Gemfibrozil 16707586
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17333356, 17681005, 16919318, 16105132, 11677210, 15861022
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 17428255, 10672840, 10737359, 11831363
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 10737359, 16942905, 12112319, 18648771, 15885732
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 16842330, 3124819
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Liver Neoplasms inferred via Clofibric Acid 17602206
Dyslipidemias inferred via Clofibrate 16707586
Niemann-Pick Disease, Type C inferred via Clofibrate 9802331
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16124888, 16227642, 15700767, 10355542, 16011737, 16050911, 16097048, 15673190
Fatty Liver inferred via Carbon Tetrachloride 16045604, 61145, 12631006, 12795759, 17595544, 16239168, 15959796
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 16227642, 15998439, 16177239, 15968718, 15027814
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 16239168, 17334410
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17805973, 17976157, 18395095, 12666154, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 16638106, 18156304, 17557913, 17525996, 16116963, 16248980, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15830285, 17285989, 16964402, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Adenocarcinoma inferred via arsenic trioxide 11798837
Blood Coagulation Disorders inferred via arsenic trioxide 16206674
Burkitt Lymphoma inferred via arsenic trioxide 11589617
Carcinoma, Hepatocellular inferred via arsenic trioxide 16217749, 11135700, 15073043, 15553829, 14691202
Carcinoma, Small Cell inferred via arsenic trioxide 12490120
Coronary Restenosis inferred via arsenic trioxide 12609071
Death, Sudden, Cardiac inferred via arsenic trioxide 15213294
Esophageal Neoplasms inferred via arsenic trioxide 12903497
Fatty Liver inferred via arsenic trioxide 15073043
Gallbladder Neoplasms inferred via arsenic trioxide 16904648
Leukemia inferred via arsenic trioxide 15070760
Leukemia-Lymphoma, Adult T-Cell inferred via arsenic trioxide 12560223, 17077332
Leukemia, Monocytic, Acute inferred via arsenic trioxide 16972261
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via arsenic trioxide 14633726
Leukemia, Myeloid, Acute inferred via arsenic trioxide 16467208, 16968895, 17050201
Leukemia, Promyelocytic, Acute inferred via arsenic trioxide 16891316, 12712474, 16331271, 17217047, 17107899, 15748426, 15336539, 15213294, 12679006, 11468182, 11161223, 16966277, 16823087, 15622746, 16330433
Leukemia, T-Cell inferred via arsenic trioxide 16882451
Liver Neoplasms inferred via arsenic trioxide 14682389
Long QT Syndrome inferred via arsenic trioxide 15213294
Lung Neoplasms inferred via arsenic trioxide 11798837
Multiple Myeloma inferred via arsenic trioxide 15949261, 14977855, 11468182
Myelodysplastic Syndromes inferred via arsenic trioxide 16105982, 16882451
Neoplasm Invasiveness inferred via arsenic trioxide 16624393
Ovarian Neoplasms inferred via arsenic trioxide 16624393, 12452020
Pancreatic Neoplasms inferred via arsenic trioxide 15580305
Sarcoma, Ewing's inferred via arsenic trioxide 16646077
Stomach Neoplasms inferred via arsenic trioxide 17007042
Torsades de Pointes inferred via arsenic trioxide 15213294
Urinary Bladder Neoplasms inferred via arsenic trioxide 12973940, 11780464, 12845720
Prostatic Neoplasms inferred via AGN 194204 16000583
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16177239, 15968718, 16227642, 14986274, 16081117, 17562736, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Adenoma inferred via 2-Acetylaminofluorene 10737359
Carcinoma, Hepatocellular inferred via 2-Acetylaminofluorene 10737359
Liver Neoplasms inferred via 2-Acetylaminofluorene 10737359, 14678523, 10672840, 11376686, 16273603, 18001218
Lung Neoplasms inferred via 2-Acetylaminofluorene 11376686
Urinary Bladder Neoplasms inferred via 2-Acetylaminofluorene 15867355, 15289314

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kathiresan S, et al. (2008) "Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans." Nat Genet. 40(2):189-197. PMID:18193044
  2. [ + ] Cao W, et al. (2008) "Acetyl-Coenzyme A acyltransferase 2 attenuates the apoptotic effects of BNIP3 in two human cell lines." Biochim Biophys Acta. 1780(6):873-880. PMID:18371312
  3. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  4. [ + ] Aboulaich N, et al. (2004) "Vectorial proteomics reveal targeting, phosphorylation and specific fragmentation of polymerase I and transcript release factor (PTRF) at the surface of caveolae in human adipocytes." Biochem J. 383(Pt 2):237-248. PMID:15242332
  5. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  6. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  7. [ + ] Seedorf U, et al. (2000) "Sterol carrier protein-2." Biochim Biophys Acta. 1486(1):45-54. PMID:10856712
  8. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  9. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298
  10. [ + ] Abe H, et al. (1993) "Cloning and sequence analysis of a full length cDNA encoding human mitochondrial 3-oxoacyl-CoA thiolase." Biochim Biophys Acta. 1216(2):304-306. PMID:8241273