0610010K14Rik | GeneID:104457 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 104457 Official Symbol 0610010K14Rik
Locus DN-160I24.7 Gene Type protein-coding
Synonyms 1110020A23Rik; AL033328; AU045833; RP23-198E14.7
Full Name RIKEN cDNA 0610010K14 gene
Description RIKEN cDNA 0610010K14 gene
Chromosome 11 B3
Also Known As OTTMUSP00000006304; hypothetical protein LOC104457
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 100582

ID Symbol Protein Species
GeneID:104457 0610010K14Rik NP_081033.1 Mus musculus
GeneID:436695 zgc:92664 NP_001002422.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005634 Component nucleus
GO:0003677 Function DNA binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_026757  UCSC Browser NP_081033 A2CF77   Q9DCT6  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000102569 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENSMUST00000102569 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENSMUST00000102569 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSMUST00000102569 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSMUST00000102569 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENSMUST00000102569 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSMUST00000102569 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSMUST00000102569 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSMUST00000102569 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENSMUST00000102569 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENSMUST00000102569 MI0000151 mmu-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENSMUST00000102569 MI0000646 mmu-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENSMUST00000102569 MI0000173 mmu-miR-151-5p UCGAGGAGCUCACAGUCUAGU
ENSMUST00000102569 MI0000176 mmu-miR-154* AAUCAUACACGGUUGACCUAUU
ENSMUST00000102569 MI0000698 mmu-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSMUST00000102569 MI0000700 mmu-miR-218-1* AAACAUGGUUCCGUCAAGCACC
ENSMUST00000102569 MI0000701 mmu-miR-218-2* CAUGGUUCUGUCAAGCACCGCG
ENSMUST00000102569 MI0000231 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000102569 MI0000572 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000102569 MI0000394 mmu-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSMUST00000102569 MI0000547 mmu-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC
ENSMUST00000102569 MI0000548 mmu-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU
ENSMUST00000102569 MI0000592 mmu-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSMUST00000102569 MI0000603 mmu-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSMUST00000102569 MI0000627 mmu-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENSMUST00000102569 MI0000632 mmu-miR-345-5p GCUGACCCCUAGUCCAGUGCUU
ENSMUST00000102569 MI0000794 mmu-miR-377 AUCACACAAAGGCAACUUUUGU
ENSMUST00000102569 MI0001447 mmu-miR-425* AUCGGGAAUGUCGUGUCCGCC
ENSMUST00000102569 MI0002405 mmu-miR-470* AACCAGUACCUUUCUGAGAAGA
ENSMUST00000102569 MI0003534 mmu-miR-487b AAUCGUACAGGGUCAUCCACUU
ENSMUST00000102569 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENSMUST00000102569 MI0005517 mmu-miR-568 AUGUAUAAAUGUAUACACAC
ENSMUST00000102569 MI0005519 mmu-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENSMUST00000102569 MI0005004 mmu-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSMUST00000102569 MI0004965 mmu-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSMUST00000102569 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSMUST00000102569 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU
ENSMUST00000102569 MI0005550 mmu-miR-873 GCAGGAACUUGUGAGUCUCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  2. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  3. [ + ] Watahiki A, et al. (2004) "Libraries enriched for alternatively spliced exons reveal splicing patterns in melanocytes and melanomas." Nat Methods. 1(3):233-239. PMID:15782199
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Blackshaw S, et al. (2004) "Genomic analysis of mouse retinal development." PLoS Biol. 2(9):E247. PMID:15226823
  6. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  8. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  9. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  10. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  11. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  12. [ + ] Ko MS, et al. (2000) "Large-scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development." Development. 127(8):1737-1749. PMID:10725249
  13. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  14. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548
  15. [ + ] Harrison SM, et al. (1995) "Isolation of novel tissue-specific genes from cDNA libraries representing the individual tissue constituents of the gastrulating mouse embryo." Development. 121(8):2479-2489. PMID:7671812