ABCA9 | GeneID:10350 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 10350 Official Symbol ABCA9
Locus N/A Gene Type protein-coding
Synonyms DKFZp686F2450; EST640918; MGC75415
Full Name ATP-binding cassette, sub-family A (ABC1), member 9
Description ATP-binding cassette, sub-family A (ABC1), member 9
Chromosome 17q24.2
Also Known As ATP-binding cassette A9; ATP-binding cassette, sub-family A, member 9
Summary This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 33332

ID Symbol Protein Species
GeneID:10350 ABCA9 NP_525022.2 Homo sapiens
GeneID:217262 Abca9 NP_671753.1 Mus musculus
GeneID:287788 Abca9 XP_221101.4 Rattus norvegicus
GeneID:504278 ABCA9 XP_870269.2 Bos taurus
GeneID:611016 ABCA9 XP_853718.1 Canis lupus familiaris
GeneID:742781 ABCA9 XP_001146190.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 acris AP16791PU-N ABCA9; antibody Ab

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCA9 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCA9 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_080283  UCSC Browser NP_525022

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000340001 MI0000811 hsa-miR-148b* AAGUUCUGUUAUACACUCAGGC
ENST00000340001 MI0000289 hsa-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENST00000340001 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000340001 MI0000440 hsa-miR-27b UUCACAGUGGCUAAGUUCUGC
ENST00000340001 MI0005775 hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG
ENST00000340001 MI0000088 hsa-miR-30a UGUAAACAUCCUCGACUGGAAG
ENST00000340001 MI0000441 hsa-miR-30b UGUAAACAUCCUACACUCAGCU
ENST00000340001 MI0000254 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000340001 MI0000736 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000340001 MI0000749 hsa-miR-30e UGUAAACAUCCUUGACUGGAAG
ENST00000340001 MI0003575 hsa-miR-551b GCGACCCAUACUUGGUUUCAG
ENST00000340001 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENST00000340001 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENST00000340001 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000340001 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000340001 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000340001 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000340001 MI0004677 mmu-miR-696 GCGUGUGCUUGCUGUGGG
ENST00000340001 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  2. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  3. [ + ] Piehler A, et al. (2002) "Molecular structure of a novel cholesterol-responsive A subclass ABC transporter, ABCA9." Biochem Biophys Res Commun. 295(2):408-416. PMID:12150964
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Dean M, et al. (2001) "The human ATP-binding cassette (ABC) transporter superfamily." Genome Res. 11(7):1156-1166. PMID:11435397
  6. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702
  7. [ + ] Hillier LD, et al. (1996) "Generation and analysis of 280,000 human expressed sequence tags." Genome Res. 6(9):807-828. PMID:8889549