ABCA10 | GeneID:10349 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 10349 Official Symbol ABCA10
Locus N/A Gene Type protein-coding
Synonyms EST698739
Full Name ATP-binding cassette, sub-family A (ABC1), member 10
Description ATP-binding cassette, sub-family A (ABC1), member 10
Chromosome 17q24
Also Known As ATP-binding cassette A10; ATP-binding cassette sub-family A member 10; ATP-binding cassette, sub-family A, member 10
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. [provided by RefSeq]

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab56663 ABCA10 antibody (ab56663); Mouse monoclonal to ABCA10
2 abnova H00010349-M01 ABCA10 monoclonal antibody (M01), clone 8F4; Mouse monoclonal antibody raised against a partial recombinant ABCA10.
3 sigma HPA014535 Anti-ABCA10 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCA10 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCA10 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_080282  UCSC Browser NP_525021

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000269081 MI0000448 hsa-miR-130a* UUCACAUUGUGCUACUGUCUGC
ENST00000269081 MI0000489 hsa-miR-195* CCAAUAUUGGCUGUGCUGCUCC
ENST00000269081 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENST00000269081 MI0000080 hsa-miR-24-1* UGCCUACUGAGCUGAUAUCAGU
ENST00000269081 MI0000081 hsa-miR-24-2* UGCCUACUGAGCUGAAACACAG
ENST00000269081 MI0000735 hsa-miR-29c* UGACCGAUUUCUCCUGGUGUUC
ENST00000269081 MI0000089 hsa-miR-31* UGCUAUGCCAACAUAUUGCCAU
ENST00000269081 MI0000760 hsa-miR-361-5p UUAUCAGAAUCUCCAGGGGUAC
ENST00000269081 MI0000782 hsa-miR-374a* CUUAUCAGAUUGUAUUGUAAUU
ENST00000269081 MI0005566 hsa-miR-374b AUAUAAUACAACCUGCUAAGUG
ENST00000269081 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENST00000269081 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENST00000269081 MI0003675 hsa-miR-411* UAUGUAACACGGUCCACUAACC
ENST00000269081 MI0003593 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000269081 MI0003598 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000269081 MI0003612 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000269081 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENST00000269081 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENST00000269081 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000269081 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000269081 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENST00000269081 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENST00000269081 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENST00000269081 MI0003676 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENST00000269081 MI0005756 hsa-miR-934 UGUCUACUACUGGAGACACUGG
ENST00000269081 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENST00000269081 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Arbutin
  • Arbutin results in decreased expression of ABCA10 mRNA
17103032

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Tao WA, et al. (2005) "Quantitative phosphoproteome analysis using a dendrimer conjugation chemistry and tandem mass spectrometry." Nat Methods. 2(8):591-598. PMID:16094384
  2. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  3. [ + ] Wenzel JJ, et al. (2003) "ABCA10, a novel cholesterol-regulated ABCA6-like ABC transporter." Biochem Biophys Res Commun. 306(4):1089-1098. PMID:12821155
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Dean M, et al. (2001) "The human ATP-binding cassette (ABC) transporter superfamily." Genome Res. 11(7):1156-1166. PMID:11435397
  6. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702