ABCA7 | GeneID:10347 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 10347 | Official Symbol | ABCA7 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | ABCA-SSN; ABCX; FLJ40025 | ||
| Full Name | ATP-binding cassette, sub-family A (ABC1), member 7 | ||
| Description | ATP-binding cassette, sub-family A (ABC1), member 7 | ||
| Chromosome | 19p13.3 | ||
| Also Known As | ATP-binding cassette, sub-family A, member 7; autoantigen SS-N; macrophage ABC transporter | ||
| Summary | The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This full transporter has been detected predominantly in myelo-lymphatic tissues with the highest expression in peripheral leukocytes, thymus, spleen, and bone marrow. The function of this protein is not yet known; however, the expression pattern suggests a role in lipid homeostasis in cells of the immune system. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 22783
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:10347 | ABCA7 | NP_061985.2 | Homo sapiens |
| GeneID:27403 | Abca7 | NP_038878.1 | Mus musculus |
| GeneID:299609 | Abca7 | NP_997481.1 | Rattus norvegicus |
| GeneID:455538 | ABCA7 | XP_512226.2 | Pan troglodytes |
| GeneID:485090 | ABCA7 | XP_542208.2 | Canis lupus familiaris |
| GeneID:511762 | ABCA7 | XP_589159.3 | Bos taurus |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | scbt | ABCA7 | ABCA7 Antibody / ABCA7 Antibodies; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0016324 | Component | apical plasma membrane |
| GO:0043190 | Component | ATP-binding cassette (ABC) transporter complex |
| GO:0005768 | Component | endosome |
| GO:0010008 | Component | endosome membrane |
| GO:0005794 | Component | Golgi apparatus |
| GO:0000139 | Component | Golgi membrane |
| GO:0016021 | Component | integral to membrane |
| GO:0005622 | Component | intracellular |
| GO:0005886 | Component | plasma membrane |
| GO:0016887 | Function | ATPase activity |
| GO:0005524 | Function | ATP binding |
| GO:0000166 | Function | nucleotide binding |
| GO:0005548 | Function | phospholipid transporter activity |
| GO:0005215 | Function | transporter activity |
| GO:0006909 | Process | phagocytosis |
| GO:0033700 | Process | phospholipid efflux |
| GO:0006810 | Process | transport |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000263094 | MI0000066 | hsa-let-7e* | CUAUACGGCCUCCUAGCUUUCC |
| ENST00000263094 | MI0000102 | hsa-miR-100 | AACCCGUAGAUCCGAACUUGUG |
| ENST00000263094 | MI0003129 | hsa-miR-146b-5p | UGAGAACUGAAUUCCAUAGGCU |
| ENST00000263094 | MI0000262 | hsa-miR-147 | GUGUGUGGAAAUGCUUCUGC |
| ENST00000263094 | MI0000239 | hsa-miR-197 | UUCACCACCUUCUCCACCCAGC |
| ENST00000263094 | MI0000074 | hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA |
| ENST00000263094 | MI0000075 | hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA |
| ENST00000263094 | MI0003130 | hsa-miR-202* | UUCCUAUGCAUAUACUUCUUUG |
| ENST00000263094 | MI0005529 | hsa-miR-220b | CCACCACCGUGUCUGACACUU |
| ENST00000263094 | MI0000107 | hsa-miR-29b-2* | CUGGUUUCACAUGGUGGCUUAG |
| ENST00000263094 | MI0003140 | hsa-miR-512-5p | CACUCAGCCUUGAGGGCACUUUC |
| ENST00000263094 | MI0003141 | hsa-miR-512-5p | CACUCAGCCUUGAGGGCACUUUC |
| ENST00000263094 | MI0003570 | hsa-miR-564 | AGGCACGGUGUCAGCAGGC |
| ENST00000263094 | MI0003581 | hsa-miR-574-3p | CACGCUCAUGCACACACCCACA |
| ENST00000263094 | MI0003597 | hsa-miR-588 | UUGGCCACAAUGGGUUAGAAC |
| ENST00000263094 | MI0003632 | hsa-miR-618 | AAACUCUACUUGUCCUUCUGAGU |
| ENST00000263094 | MI0003667 | hsa-miR-652 | AAUGGCGCCACUAGGGUUGUG |
| ENST00000263094 | MI0003670 | hsa-miR-662 | UCCCACGUUGUGGCCCAGCAG |
| ENST00000263094 | MI0005760 | hsa-miR-938 | UGCCCUUAAAGGUGAACCCAGU |
| ENST00000263094 | MI0001526 | mmu-miR-434-5p | GCUCGACUCAUGGUUUGAACCA |
| ENST00000263094 | MI0005511 | mmu-miR-466h | UGUGUGCAUGUGCUUGUGUGUA |
| ENST00000263094 | MI0003518 | mmu-miR-540-3p | AGGUCAGAGGUCGAUCCUGG |
| ENST00000263094 | MI0004523 | mmu-miR-669a | AGUUGUGUGUGCAUGUUCAUGU |
| ENST00000263094 | MI0004667 | mmu-miR-669a | AGUUGUGUGUGCAUGUUCAUGU |
| ENST00000263094 | MI0004668 | mmu-miR-669a | AGUUGUGUGUGCAUGUUCAUGU |
| ENST00000263094 | MI0004673 | mmu-miR-669c | AUAGUUGUGUGUGGAUGUGUGU |
| ENST00000263094 | MI0004640 | mmu-miR-680 | GGGCAUCUGCUGACAUGGGGG |
| ENST00000263094 | MI0004641 | mmu-miR-680 | GGGCAUCUGCUGACAUGGGGG |
| ENST00000263094 | MI0004642 | mmu-miR-680 | GGGCAUCUGCUGACAUGGGGG |
| ENST00000263094 | MI0004682 | mmu-miR-698 | CAUUCUCGUUUCCUUCCCU |
| ENST00000263094 | MI0004684 | mmu-miR-700 | CACGCGGGAACCGAGUCCACC |
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| Acetaminophen | |
|
|
| Ethinyl Estradiol | |
|
|
| pirinixic acid | |
|
|
| testosterone enanthate | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Disease Name | Relationship | PubMed |
|---|---|---|
| HIV Wasting Syndrome | inferred via testosterone enanthate | 17440010 |
| Edema | inferred via pirinixic acid | 12083418 |
| Liver Neoplasms | inferred via pirinixic acid | 15890375 |
| Acne Vulgaris | inferred via Ethinyl Estradiol | 17505938 |
| Adenocarcinoma | inferred via Ethinyl Estradiol | 14692618 |
| Arteriosclerosis | inferred via Ethinyl Estradiol | 11256880 |
| Arthritis, Experimental | inferred via Ethinyl Estradiol | 15885639 |
| Cholestasis | inferred via Ethinyl Estradiol | 17110522, 16919318, 17681005, 16105132, 11677210, 15861022, 17333356 |
| Encephalomyelitis, Autoimmune, Experimental | inferred via Ethinyl Estradiol | 12538720 |
| Fatty Liver | inferred via Ethinyl Estradiol | 15345470 |
| Hypospadias | inferred via Ethinyl Estradiol | 16569931, 16945680 |
| Infertility, Female | inferred via Ethinyl Estradiol | 12013081 |
| Infertility, Male | inferred via Ethinyl Estradiol | 17937319 |
| Panic Disorder | inferred via Ethinyl Estradiol | 11578682 |
| Pruritus | inferred via Ethinyl Estradiol | 16919318, 15861022 |
| Spermatocele | inferred via Ethinyl Estradiol | 16709447 |
| Thrombophilia | inferred via Ethinyl Estradiol | 11994571 |
| Thrombosis | inferred via Ethinyl Estradiol | 15669648 |
| Uterine Neoplasms | inferred via Ethinyl Estradiol | 14692618 |
| Venous Thrombosis | inferred via Ethinyl Estradiol | 15869587 |
| Hepatitis, Toxic | inferred via Acetaminophen | 2444490, 17562736, 17522070, 16081117, 14986274, 16227642, 15968718, 16177239 |
| Hyperalgesia | inferred via Acetaminophen | 16870215 |
| Liver Failure, Acute | inferred via Acetaminophen | 16871587, 17185352 |
| Pain | inferred via Acetaminophen | 16870215 |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046 - [
] Hosgood HD 3rd, et al. (2008) "Pathway-based evaluation of 380 candidate genes and lung cancer susceptibility suggests the importance of the cell cycle pathway." Carcinogenesis. 29(10):1938-1943. PMID:18676680 - [
] Jehle AW, et al. (2006) "ATP-binding cassette transporter A7 enhances phagocytosis of apoptotic cells and associated ERK signaling in macrophages." J Cell Biol. 174(4):547-556. PMID:16908670 - [
] Harangi M, et al. (2005) "Homozygosity for the 168His variant of the minor histocompatibility antigen HA-1 is associated with reduced risk of primary Sjogren's syndrome." Eur J Immunol. 35(1):305-317. PMID:15593299 - [
] Hayashi M, et al. (2005) "Heterogeneity of high density lipoprotein generated by ABCA1 and ABCA7." J Lipid Res. 46(8):1703-1711. PMID:15930518 - [
] Abe-Dohmae S, et al. (2004) "Human ABCA7 supports apolipoprotein-mediated release of cellular cholesterol and phospholipid to generate high density lipoprotein." J Biol Chem. 279(1):604-611. PMID:14570867 - [
] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039 - [
] Fu GK, et al. (2004) "Circular rapid amplification of cDNA ends for high-throughput extension cloning of partial genes." Genomics. 84(1):205-210. PMID:15203218 - [
] Wang N, et al. (2003) "ATP-binding cassette transporter A7 (ABCA7) binds apolipoprotein A-I and mediates cellular phospholipid but not cholesterol efflux." J Biol Chem. 278(44):42906-42912. PMID:12917409 - [
] Kielar D, et al. (2003) "Adenosine triphosphate binding cassette (ABC) transporters are expressed and regulated during terminal keratinocyte differentiation: a potential role for ABCA7 in epidermal lipid reorganization." J Invest Dermatol. 121(3):465-474. PMID:12925201 - [
] Ikeda Y, et al. (2003) "Posttranscriptional regulation of human ABCA7 and its function for the apoA-I-dependent lipid release." Biochem Biophys Res Commun. 311(2):313-318. PMID:14592415 - [
] Iida A, et al. (2002) "Catalog of 605 single-nucleotide polymorphisms (SNPs) among 13 genes encoding human ATP-binding cassette transporters: ABCA4, ABCA7, ABCA8, ABCD1, ABCD3, ABCD4, ABCE1, ABCF1, ABCG1, ABCG2, ABCG4, ABCG5, and ABCG8." J Hum Genet. 47(6):285-310. PMID:12111378 - [
] Tanaka AR, et al. (2001) "Human ABCA1 contains a large amino-terminal extracellular domain homologous to an epitope of Sjogren's Syndrome." Biochem Biophys Res Commun. 283(5):1019-1025. PMID:11355874 - [
] Broccardo C, et al. (2001) "Comparative analysis of the promoter structure and genomic organization of the human and mouse ABCA7 gene encoding a novel ABCA transporter." Cytogenet Cell Genet. 92(3-4):264-270. PMID:11435699 - [
] Kaminski WE, et al. (2000) "Identification of a novel human sterol-sensitive ATP-binding cassette transporter (ABCA7)." Biochem Biophys Res Commun. 273(2):532-538. PMID:10873640 - [
] Niwa M, et al. (2000) "Affinity selection of cDNA libraries by lambda phage surface display." Gene. 256(1-2):229-236. PMID:11054552 - [
] Kaminski WE, et al. (2000) "Genomic organization of the human cholesterol-responsive ABC transporter ABCA7: tandem linkage with the minor histocompatibility antigen HA-1 gene." Biochem Biophys Res Commun. 278(3):782-789. PMID:11095984
With dense single-nucleotide polymorphism (SNP) maps for 199 drug-related genes, we examined associations between 4190 SNPs and 38 commonly measured quantitative traits using data from 752 healthy Japanese subjects. On analysis, we observed a strong association between five SNPs within the uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1) gene and serum total bilirubin levels (minimum P-value in Mann-Whitney test=1.82 x 10(10)). UGT1A1 catalyzes the conjugation of bilirubin with glucuronic acid, thus enhancing bilirubin elimination. This enzyme is known to play an important role in the variation of serum bilirubin levels. The five SNPs, including a nonsynonymous SNP-rs4148323 (211G>A or G71R variant allele known as UGT1A1*6)-showed strong linkage disequilibrium with each other. No other genes were clearly associated with serum total bilirubin levels. Results of linear multiple regression analysis on serum total bilirubin levels followed by analysis of variance showed that at least 13% of the variance in serum total bilirubin levels could be explained by three haplotype-tagging SNPs in the UGT1A1 gene.Journal of Human Genetics (2009) 54, 317-323; doi:10.1038/jhg.2009.31; published online 3 April 2009.
Common genetic variation may play an important role in altering lung cancer risk. We conducted a pathway-based candidate gene evaluation to identify genetic variations that may be associated with lung cancer in a population-based case-control study in Xuan Wei, China (122 cases and 111 controls). A total of 1260 single-nucleotide polymorphisms (SNPs) in 380 candidate genes for lung cancer were successfully genotyped and assigned to one of 10 pathways based on gene ontology. Logistic regression was used to assess the marginal effect of each SNP on lung cancer susceptibility. The minP test was used to identify statistically significant associations at the gene level. Important pathways were identified using a test of proportions and the rank truncated product methods. The cell cycle pathway was found as the most important pathway (P = 0.044) with four genes significantly associated with lung cancer (PLA2G6 minP = 0.001, CCNA2 minP = 0.006, GSK3 beta minP = 0.007 and EGF minP = 0.013), after adjusting for multiple comparisons. Interestingly, most cell cycle genes that were associated with lung cancer in this analysis were concentrated in the AKT signaling pathway, which is essential for regulation of cell cycle progression and cellular survival, and may be important in lung cancer etiology in Xuan Wei. These results should be viewed as exploratory until they are replicated in a larger study.
The mammalian ATP-binding cassette transporters A1 and A7 (ABCA1 and -A7) show sequence similarity to CED-7, a Caenorhabditis elegans gene that mediates the clearance of apoptotic cells. Using RNA interference or gene targeting, we show that knock down of macrophage ABCA7 but not -A1 results in defective engulfment of apoptotic cells. In response to apoptotic cells, ABCA7 moves to the macrophage cell surface and colocalizes with the low-density lipoprotein receptor-related protein 1 (LRP1) in phagocytic cups. The cell surface localization of ABCA7 and LRP1 is defective in ABCA7-deficient cells. C1q is an opsonin of apoptotic cells that acts via phagocyte LRP1 to induce extracellular signal-regulated kinase (ERK) signaling. We show that ERK signaling is required for phagocytosis of apoptotic cells and that ERK phosphorylation in response to apoptotic cells or C1q is defective in ABCA7-deficient cells. These studies reveal a major role of ABCA7 and not -A1 in the clearance of apoptotic cells and therefore suggest that ABCA7 is an authentic orthologue of CED-7.
The genes for the human ATP-binding cassette (ABC) transporter ABCA7 and the minor histocompatibility antigen HA-1 are juxtaposed in close proximity on chromosome 19p13.3. The multispan transmembrane protein ABCA7 contains an extracellular domain that is recognized by antisera from patients with Sjogren's syndrome ("Sjogren-epitope"). Recent work from our laboratory demonstrating the involvement of ABCA7 in cellular ceramide and phosphatidylserine export suggests a role for this transporter in programmed cell death. In HA-1, a protein of unknown function, a His/Arg polymorphism (His168Arg), which constitutes the immunologic target for HA-1-specific cytotoxic T cells, has been causatively linked to graft-versus-host disease after allogeneic stem cell transplantation. Because these findings suggest a potential implication of ABCA7 and HA-1 in immune processes, we tested the hypothesis that allelic variants in both genes are associated with autoimmune disorders. We identified a total of 31 exonic single-nucleotide polymorphisms (SNP) in the ABCA7/HA-1 gene complex, nine of which represent non-synonymous nucleotide alterations. Genotypes of ABCA7 and HA-1 SNP were determined in three distinct Caucasian populations of patients with primary Sjogren's syndrome and ethnically matched controls. Comparison of allele frequencies between these groups revealed that the incidence of the HA-1 168His allele is significantly lower in Sjogren's syndrome patients than in controls (p<0.003). In contrast, the frequencies of all ABCA7 allelic variants and additional HA-1 polymorphisms were similar in patients and controls. In cohorts of patients with systemic lupus erythematosus, rheumatoid arthritis and multiple sclerosis, no significant differences in the frequencies of ABCA7 and HA-1 allelic variants were observed relative to controls. Our results suggest that the HA-1 168His variant is associated with reduced susceptibility to primary Sjogren's syndrome.
The assembly of HDL by helical apolipoprotein and cellular lipid was studied using HEK293 cells to which ecdysone-inducible human ABCA1 or human ABCA7 was transfected. Expression of both ABCA1 and ABCA7 was induced linearly proportional to ponasterone A concentration in the medium. In the experimental conditions used, the ABC protein expression levels limited the rate of lipid release when the apolipoprotein concentration was high, and the apolipoprotein concentration was rate-limiting when the ABC protein expression levels were high. When ABCA1 expression increased in conditions in which it was rate-limiting, relative cholesterol content to phospholipid increased in the HDL produced. In contrast, it was constant when ABCA7 expression increased. To investigate the background mechanism, the HDL particles were analyzed by density gradient ultracentrifugation and high performance lipid chromatography. The ABCA1-mediated reaction produced two distinct HDLs, large cholesterol-rich and small cholesterol-poor particles, and the ABCA7-mediated reaction generated mostly small cholesterol-poor particles. The increase of HDL assembly with the increase of ABCA1 expression was predominant in large cholesterol-rich particles, whereas only small cholesterol-poor HDL increased as ABCA7 expression increased. We conclude that ABCA1 generates cholesterol-rich and cholesterol-poor HDL and that the former is more prominently dependent on the increase of ABCA1 expression. ABCA7 produces this HDL subfraction only as a very minor component.
Apolipoprotein-mediated release of cellular cholesterol and phospholipids was induced in HEK293 cells by expressing human ATP-binding cassette transporter A7 (ABCA7) and ABC transporter A1 (ABCA1) proteins, whether transient or stable, to generate cholesterol-rich high density lipoprotein (HDL). Green fluorescent protein (GFP) attached at their C termini did not influence the lipid release reactions. Transfected ABCA7-GFP induced apolipoprotein-mediated assembly of cholesterol-containing HDL also in L929 cells, which otherwise generate only cholesterol-deficient HDL with their endogenous ABCA1. Time-dependent release of cholesterol and phospholipid by apolipoprotein A (apoA)-I was parallel both with ABCA1 and with ABCA7 when highly expressed in HEK293 cells, but dose-dependent profiles of lipid release on apoA-I and apoA-II were somewhat different between ABCA1 and ABCA7. Analyses of the stable clones with ABCA1-GFP (293/2c) and ABCA7-GFP (293/6c) by using the same vector indicated some differences in regulation of their activities by protein kinase modulators. Dibutyryl cyclic AMP increased ABCA1-GFP and the release of cholesterol and phospholipid in 293/2c but increased neither ABCA7-GFP nor the lipid release in 293/6c. Expression of ABCA1-GFP- and apoA-I-mediated lipid release were enhanced in parallel by phorbol 12-myristate 13-acetate (PMA) in 293/2c cells. In contrast, the same treatment of 293/6c increased ABCA7-GFP, but apoA-I-mediated lipid release was significantly suppressed. Despite these different responses to PMA, all of the effects of PMA were reversed by a specific protein kinase C inhibitor Go6976, suggesting that the changes were in fact due to protein kinase C activation. A thiol protease inhibitor, N-acetyl-Leu-Leu-norleucinal, increased the protein levels of ABCA1-GFP in 293/2c and ABCA7-GFP in 293/6c, indicating their common degradation pathway. The data indicated that human ABCA7 would compensate the function of ABCA1 for release of cell cholesterol in a certain condition(s), but post-transcriptional regulation of their activity is different.
As a base for human transcriptome and functional genomics, we created the "full-length long Japan" (FLJ) collection of sequenced human cDNAs. We determined the entire sequence of 21,243 selected clones and found that 14,490 cDNAs (10,897 clusters) were unique to the FLJ collection. About half of them (5,416) seemed to be protein-coding. Of those, 1,999 clusters had not been predicted by computational methods. The distribution of GC content of nonpredicted cDNAs had a peak at approximately 58% compared with a peak at approximately 42%for predicted cDNAs. Thus, there seems to be a slight bias against GC-rich transcripts in current gene prediction procedures. The rest of the cDNAs unique to the FLJ collection (5,481) contained no obvious open reading frames (ORFs) and thus are candidate noncoding RNAs. About one-fourth of them (1,378) showed a clear pattern of splicing. The distribution of GC content of noncoding cDNAs was narrow and had a peak at approximately 42%, relatively low compared with that of protein-coding cDNAs.
The rapid amplification of cDNA ends (RACE) procedure is a widely used PCR-based method to clone the cDNA ends of mRNA transcripts. Current RACE methods often produce a high background of nonspecific PCR products, which can exclude the identification of the target cDNA of interest. We describe here an improved RACE procedure using circular cDNA templates and demonstrate the successful extension cloning of 4406 cDNAs.
ATP-binding cassette transporter 1 (ABCA1), the defective transporter in Tangier disease, binds and promotes cellular cholesterol and phospholipid efflux to apolipoprotein I (apoA-I). Based on a high degree of sequence homology between ABCA1 and ABCA7, a transporter of unknown function, we investigated the possibility that ABCA7 might be involved in apolipoprotein binding and lipid efflux. Similarly to cells expressing ABCA1, HEK293 cells overexpressing ABCA7 showed specific binding and cross-linking of lipid-poor apoA-I. ABCA7 expression increased cellular phosphatidylcholine and sphingomyelin efflux to apoA-I in a manner similar to ABCA1 but had no effect on cholesterol efflux. Western analysis showed a high protein level of ABCA7 in mouse spleen, lung, adrenal, and brain but low expression in liver. In contrast to ABCA1, ABCA7 showed moderate basal mRNA and protein levels in macrophages and lymphocytes but no induction by liver X receptor activation. These studies show that ABCA7 has the ability to bind apolipoproteins and promote efflux of cellular phospholipids without cholesterol, and they suggest a possible role of ABCA7 in cellular phospholipid metabolism in peripheral tissues.
Central aspects of the cellular lipid trafficking mechanisms that occur during keratinocyte differentiation are still not well understood. In the past years, evidence has accumulated to suggest that members of the superfamily of adenosine triphosphate binding cassette (ABC) transporters are critically involved in the transmembrane transport of cellular lipids. To test the hypothesis that ABC molecules are potentially involved in the epidermal transport of sphingolipids, glycerophospholipids, cholesterol, and fatty acids, we performed mRNA expression profiling of all currently known ABC molecules during in vitro differentiation of human keratinocytes and HaCaT cells. We identified six ABC molecules that displayed significant regulation during differentiation of these cells. The recently cloned transporter ABCA7 was highly expressed in keratinocytes and HaCaT cells and upregulated during differentiation. Overexpression of ABCA7 in HeLa cells resulted in increased expression of intracellular and cell surface ceramide and elevated intracellular phosphatidylserine levels. Given the observation that during terminal keratinocyte differentiation intracellular and surface ceramide levels are increased, our results render ABCA7 a candidate regulator of ceramide transport in this process. In addition to ABCA7, the cholesterol transporters ABCB1 and ABCG1 and the glutathione/glucuronide sulfate transporters ABCC1, ABCC3, and ABCC4, were strongly upregulated during keratinocyte and HaCaT cell differentiation. These findings support the notion that ABCB1 and ABCG1 are potentially implicated in cholesterol transport, whereas ABCC1, ABCC3, and ABCC4 are candidate regulators of the translocation of sulfated lipids during stratum corneum keratinization. Our results suggest specific biologic functions for members of the ABC transporter family in epidermal lipid reorganization during terminal keratinocyte differentiation.
ABCA7 is expressed predominantly in myelo-lymphatic tissues or reticuloendothelial cells. Physiological role and function of this protein are not fully understood. We isolated the full-length cDNA (type I) and a splicing variant cDNA (type II) of human ABCA7, and developed monoclonal antibodies against extracellular domain (ECD)1 of ABCA7. RT-PCR experiments suggested that human ABCA7 gene produced the type II mRNA in a tissue-specific manner. Immunostaining revealed that the type I ABCA7, expressed in HEK293 cells, was localized to the plasma membrane and ECD1 was exposed to the extracellular space as was the case for ABCA1. HEK293 cells expressing type I ABCA7 showed apoA-I-dependent cholesterol and phospholipid release. In contrast, type II ABCA7 appeared to be localized mainly in endoplasmic reticulum and did not show apoA-I-dependent cholesterol and phospholipid release. Alternative splicing could be involved in the post-transcriptional regulation of the expression and function of human ABCA7.
Single-nucleotide polymorphisms (SNPs) at some gene loci are useful as markers of individual risk for adverse drug reactions or susceptibility to complex diseases. We have been focusing on identifying SNPs in and around genes encoding drug-metabolizing enzymes and transporters, and have constructed several high-density SNP maps of such regions. Here we report SNPs at additional loci, specifically 13 genes belonging to the superfamily of ATP-binding cassette transporters ( ABCA4, ABCA7, ABCA8, ABCD1, ABCD3, ABCD4, ABCE1, ABCF1, ABCG1, ABCG2, ABCG4, ABCG5, and ABCG8). Sequencing a total of 416 kb of genomic DNA from 48 Japanese volunteers identified 605 SNPs among these 13 loci: 14 in 5' flanking regions, 5 in 5' untranslated regions, 37 within coding elements, 529 in introns, 8 in 3' untranslated regions, and 12 in 3' flanking regions. By comparing our data with SNPs deposited in the dbSNP database of the National Center for Biotechnology Information (US) and with published reports, we determined that 491 (81%) of the SNPs reported here were novel. We also detected 107 genetic variations of other types among the loci examined (insertion-deletions or mono- di-, or trinucleotide polymorphisms). The high-density SNP maps we constructed on the basis of these data should provide useful information for investigating associations between genetic variations and common diseases or responsiveness to drug therapy.
ABCA1 has been suggested to play a key role in cellular lipid release from peripheral cells. In order to study structure-function relationship of this protein, the protein product of a full-length human ABCA1 cDNA was examined for its functions and topological orientation. The electrophoretic mobilities of human ABCA1 expressed in transfected cells increased when treated with N-glycosidase F, suggesting that ABCA1 is highly glycosylated. The ABCA1 was photoaffinity-labeled with ATP and mediated the apoA-I-dependent-release of cholesterol and phospholipid. The influenza hemagglutinin (HA) epitope was introduced into the amino-terminus (N-HA) or between the residues 207 and 208 (207-HA) of the protein. While an antibody against the C-terminus peptide of ABCA1 detected both fusion proteins, an anti-HA antibody did not react with the N-HA fusion protein. Confocal microscopy demonstrated strong cell surface signal with the anti-HA antibody of nonpermeabilized HEK293 cells expressing the 207-HA fusion protein. The results suggested that the signal peptide in the amino-terminal region is cleaved off in its mature form and that the following large hydrophilic region is exposed to outside of cells unlike previously proposed models. We found that this amino-terminal extracellular domain contains a segment homologous to the autoantigen SS-N, an epitope of Sjogren's syndrome, and further identified that ABCA7 codes for the autoantigen SS-N.
We report here the genomic and transcriptional characterization in mouse and man of a novel transporter of the ABCA subclass, named ABCA7. As it is the case for other ABCA genes, the predicted protein encoded by ABCA7 is a full symmetric transporter, highly conserved across species. The ABCA7 gene maps to human chromosome 19 and to the homologous region at band B4-C1 on mouse chromosome 10. The preferential expression of ABCA7 in the spleen, thymus, and fetal liver is consistent with the finding, in both human and mouse promoter, of sites targeted by lymphomyeloid-specific transcription factors. This suggests that ABCA7 may play a pivotal role in the developmental specification of hematopoietic cell lineages.
We report the identification of the full-length cDNA for a novel ATP-binding cassette (ABC) transporter from human macrophages. The mRNA is of 6.8 kb size and contains an open reading frame encoding a polypeptide of 2146 amino acids with a calculated molecular weight of 220 kDa. The predicted protein product is composed of two transmembrane domains and two nucleotide binding folds indicating that it pertains to the group of full-size ABC transporters. The novel transporter shows highest protein sequence homology with the recently cloned human cholesterol and phospholipid exporter ABCA1 (54%) and the human retinal transporter ABCR (49%), both members of the ABC transporter subfamily A. In accordance with the currently proposed classification, the novel transporter was designated ABCA7. ABCA7 mRNA was detected predominantly in myelo-lymphatic tissues with highest expression in peripheral leukocytes, thymus, spleen, and bone marrow. Expression of ABCA7 is induced during in vitro differentiation of human monocytes into macrophages. In macrophages, both the ABCA7 mRNA and protein expression are upregulated in the presence of modified low density lipoprotein and downregulated by HDL(3). Our results suggest a role for ABCA7 in macrophage transmembrane lipid transport.
Bacteriophage lambda surface display was used to isolate cDNA clones encoding autoantigens recognized by sera from patients with Sjogren's syndrome (SS). We made cDNA libraries from human HeLa and HepG2 cells, using the expression vector lambdafoo. By repeating affinity selection of the libraries with the sera immobilized in microtiter wells, we isolated three clones that encode previously unknown antigens as well as four clones previously known as SS autoantigens. The newly identified autoantigens include TRK-fused gene product (TFG), survival motor neuron gene product (SMN) and pM5, which has a similarity to the metal-binding domain of human fibroblast collagenase. Thus, the bacteriophage lambda surface display is powerful for isolating cDNA clones by affinity screening.
We have recently cloned a novel cholesterol-responsive ABC transporter, designated ABCA7, which is predominantly expressed in human leukocytes. Here we report the structure of the human ABCA7 gene. The ABCA7 gene spans a region of approximately 32 kb and comprises 46 exons. Its putative promoter sequence contains potential binding sites for transcription factors with roles in hematopoiesis and cholesterol metabolism. Surprisingly, sequence analysis of the ABCA7 3' gene flanking region revealed that the terminal exon of ABCA7 borders immediately on the 5' end of the coding region of the recently identified human minor histocompatibility antigen HA-1. We demonstrate that the coding regions of ABCA7 and HA-1 are physically separated by a 1.7-kb intergene region. Subsequent genomic structure analysis showed that the HA-1 gene consists of 23 exons which extend across a 16-kb genomic region. Our results provide evidence that the genes for the human minor histocompatibility antigen HA-1 and the ABC transporter ABCA7 are arranged in a head-to-tail array and that both genes localize to a common locus of approximately 48 kb size on chromosome 19p13.3.

