ABCA7 | GeneID:10347 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 10347 Official Symbol ABCA7
Locus N/A Gene Type protein-coding
Synonyms ABCA-SSN; ABCX; FLJ40025
Full Name ATP-binding cassette, sub-family A (ABC1), member 7
Description ATP-binding cassette, sub-family A (ABC1), member 7
Chromosome 19p13.3
Also Known As ATP-binding cassette, sub-family A, member 7; autoantigen SS-N; macrophage ABC transporter
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This full transporter has been detected predominantly in myelo-lymphatic tissues with the highest expression in peripheral leukocytes, thymus, spleen, and bone marrow. The function of this protein is not yet known; however, the expression pattern suggests a role in lipid homeostasis in cells of the immune system. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22783

ID Symbol Protein Species
GeneID:10347 ABCA7 NP_061985.2 Homo sapiens
GeneID:27403 Abca7 NP_038878.1 Mus musculus
GeneID:299609 Abca7 NP_997481.1 Rattus norvegicus
GeneID:455538 ABCA7 XP_512226.2 Pan troglodytes
GeneID:485090 ABCA7 XP_542208.2 Canis lupus familiaris
GeneID:511762 ABCA7 XP_589159.3 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 scbt ABCA7 ABCA7 Antibody / ABCA7 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCA7 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCA7 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016324 Component apical plasma membrane
GO:0043190 Component ATP-binding cassette (ABC) transporter complex
GO:0005768 Component endosome
GO:0010008 Component endosome membrane
GO:0005794 Component Golgi apparatus
GO:0000139 Component Golgi membrane
GO:0016021 Component integral to membrane
GO:0005622 Component intracellular
GO:0005886 Component plasma membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005548 Function phospholipid transporter activity
GO:0005215 Function transporter activity
GO:0006909 Process phagocytosis
GO:0033700 Process phospholipid efflux
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_019112  UCSC Browser NP_061985

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000263094 MI0000066 hsa-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENST00000263094 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENST00000263094 MI0003129 hsa-miR-146b-5p UGAGAACUGAAUUCCAUAGGCU
ENST00000263094 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENST00000263094 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENST00000263094 MI0000074 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000263094 MI0000075 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000263094 MI0003130 hsa-miR-202* UUCCUAUGCAUAUACUUCUUUG
ENST00000263094 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000263094 MI0000107 hsa-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENST00000263094 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000263094 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000263094 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENST00000263094 MI0003581 hsa-miR-574-3p CACGCUCAUGCACACACCCACA
ENST00000263094 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENST00000263094 MI0003632 hsa-miR-618 AAACUCUACUUGUCCUUCUGAGU
ENST00000263094 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENST00000263094 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENST00000263094 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENST00000263094 MI0001526 mmu-miR-434-5p GCUCGACUCAUGGUUUGAACCA
ENST00000263094 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000263094 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENST00000263094 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000263094 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000263094 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000263094 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENST00000263094 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000263094 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000263094 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000263094 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENST00000263094 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABCA7 mRNA
17562736
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ABCA7 mRNA
17555576
pirinixic acid
  • pirinixic acid results in decreased expression of ABCA7 mRNA
17426115
testosterone enanthate
  • testosterone enanthate affects the expression of ABCA7 mRNA
17440010

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
HIV Wasting Syndrome inferred via testosterone enanthate 17440010
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 17681005, 16105132, 11677210, 15861022, 17333356
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17562736, 17522070, 16081117, 14986274, 16227642, 15968718, 16177239
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Hosgood HD 3rd, et al. (2008) "Pathway-based evaluation of 380 candidate genes and lung cancer susceptibility suggests the importance of the cell cycle pathway." Carcinogenesis. 29(10):1938-1943. PMID:18676680
  3. [ + ] Jehle AW, et al. (2006) "ATP-binding cassette transporter A7 enhances phagocytosis of apoptotic cells and associated ERK signaling in macrophages." J Cell Biol. 174(4):547-556. PMID:16908670
  4. [ + ] Harangi M, et al. (2005) "Homozygosity for the 168His variant of the minor histocompatibility antigen HA-1 is associated with reduced risk of primary Sjogren's syndrome." Eur J Immunol. 35(1):305-317. PMID:15593299
  5. [ + ] Hayashi M, et al. (2005) "Heterogeneity of high density lipoprotein generated by ABCA1 and ABCA7." J Lipid Res. 46(8):1703-1711. PMID:15930518
  6. [ + ] Abe-Dohmae S, et al. (2004) "Human ABCA7 supports apolipoprotein-mediated release of cellular cholesterol and phospholipid to generate high density lipoprotein." J Biol Chem. 279(1):604-611. PMID:14570867
  7. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  8. [ + ] Fu GK, et al. (2004) "Circular rapid amplification of cDNA ends for high-throughput extension cloning of partial genes." Genomics. 84(1):205-210. PMID:15203218
  9. [ + ] Wang N, et al. (2003) "ATP-binding cassette transporter A7 (ABCA7) binds apolipoprotein A-I and mediates cellular phospholipid but not cholesterol efflux." J Biol Chem. 278(44):42906-42912. PMID:12917409
  10. [ + ] Kielar D, et al. (2003) "Adenosine triphosphate binding cassette (ABC) transporters are expressed and regulated during terminal keratinocyte differentiation: a potential role for ABCA7 in epidermal lipid reorganization." J Invest Dermatol. 121(3):465-474. PMID:12925201
  11. [ + ] Ikeda Y, et al. (2003) "Posttranscriptional regulation of human ABCA7 and its function for the apoA-I-dependent lipid release." Biochem Biophys Res Commun. 311(2):313-318. PMID:14592415
  12. [ + ] Iida A, et al. (2002) "Catalog of 605 single-nucleotide polymorphisms (SNPs) among 13 genes encoding human ATP-binding cassette transporters: ABCA4, ABCA7, ABCA8, ABCD1, ABCD3, ABCD4, ABCE1, ABCF1, ABCG1, ABCG2, ABCG4, ABCG5, and ABCG8." J Hum Genet. 47(6):285-310. PMID:12111378
  13. [ + ] Tanaka AR, et al. (2001) "Human ABCA1 contains a large amino-terminal extracellular domain homologous to an epitope of Sjogren's Syndrome." Biochem Biophys Res Commun. 283(5):1019-1025. PMID:11355874
  14. [ + ] Broccardo C, et al. (2001) "Comparative analysis of the promoter structure and genomic organization of the human and mouse ABCA7 gene encoding a novel ABCA transporter." Cytogenet Cell Genet. 92(3-4):264-270. PMID:11435699
  15. [ + ] Kaminski WE, et al. (2000) "Identification of a novel human sterol-sensitive ATP-binding cassette transporter (ABCA7)." Biochem Biophys Res Commun. 273(2):532-538. PMID:10873640
  16. [ + ] Niwa M, et al. (2000) "Affinity selection of cDNA libraries by lambda phage surface display." Gene. 256(1-2):229-236. PMID:11054552
  17. [ + ] Kaminski WE, et al. (2000) "Genomic organization of the human cholesterol-responsive ABC transporter ABCA7: tandem linkage with the minor histocompatibility antigen HA-1 gene." Biochem Biophys Res Commun. 278(3):782-789. PMID:11095984