ABCC4 | GeneID:10257 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 10257 Official Symbol ABCC4
Locus RP11-74A12.1 Gene Type protein-coding
Synonyms EST170205; MOAT-B; MOATB; MRP4
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Chromosome 13q32
Also Known As ATP-binding cassette, sub-family C, member 4; OTTHUMP00000018560; bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4); canalicular multispecific organic anion transporter (ABC superfamily); multidrug resistance-associated protein 4; multispecific organic anion transporter B
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in cellular detoxification as a pump for its substrate, organic anions. Alternative splicing results in multiple splice variants encoding different isoforms. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74563

ID Symbol Protein Species
GeneID:10257 ABCC4 NP_005836.2 Homo sapiens
GeneID:35163 CG31792 NP_724148.1 Drosophila melanogaster
GeneID:47905 l(2)03659 NP_610482.2 Drosophila melanogaster
GeneID:170924 Abcc4 NP_596902.1 Rattus norvegicus
GeneID:180691 mrp-6 NP_508710.2 Caenorhabditis elegans
GeneID:239273 Abcc4 NP_001028508.1 Mus musculus
GeneID:368620 abcc4 NP_001007039.1 Danio rerio
GeneID:418791 ABCC4 NP_001025990.1 Gallus gallus
GeneID:452625 ABCC4 XP_001137006.1 Pan troglodytes
GeneID:485523 ABCC4 XP_542642.2 Canis lupus familiaris
GeneID:515333 ABCC4 XP_593336.2 Bos taurus
GeneID:820496 ATMRP3 NP_187915.1 Arabidopsis thaliana
GeneID:820497 ATMRP8 NP_187916.3 Arabidopsis thaliana
GeneID:820498 ATMRP7 NP_187917.3 Arabidopsis thaliana
GeneID:4327122 Os01g0173900 NP_001042159.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab56675 MRP4 antibody (ab56675); Mouse monoclonal to MRP4
2 abcam ab32550 MRP4 antibody (ab32550); Rabbit polyclonal to MRP4
3 abcam ab15602 MRP4 antibody [M4I-10] (ab15602); Rat monoclonal [M4I-10] to MRP4
4 abcam ab15598 MRP4 antibody [M4I-80] (ab15598); Rat monoclonal [M4I-80] to MRP4
5 abgent AP7436b ABCC4 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
6 abnova H00010257-M03 ABCC4 monoclonal antibody (M03), clone 1B2; Mouse monoclonal antibody raised against a partial recombinant ABCC4.
7 acris AP16289PU-N ABCC4 / MRP4; antibody Ab
8 acris AP07612PU-N ABCC4 / MRP4; antibody Ab
9 acris AP08916PU-N ABCC4 / MRP4 (aa 1249-1268); antibody Ab
10 acris AP14083PU-N ABCC4 / MRP4 (C-term); antibody Ab
11 scbt ABCC4 ABCC4 Antibody / ABCC4 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCC4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCC4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0016021 Component integral to membrane
GO:0005624 Component membrane fraction
GO:0005886 Component plasma membrane
GO:0031088 Component platelet dense granule membrane
GO:0016404 Function 15-hydroxyprostaglandin dehydrogenase (NAD+) activity
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0005254 Function chloride channel activity
GO:0000166 Function nucleotide binding
GO:0008150 Process biological_process
GO:0006811 Process ion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001105515  UCSC Browser NP_001098985 Q8IVZ4   O15439  
2 NM_005845  UCSC Browser NP_005836

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000376887 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000376887 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000376887 MI0000812 hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENST00000376887 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000376887 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000376887 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENST00000376887 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENST00000376887 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENST00000376887 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENST00000376887 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENST00000376887 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENST00000376887 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000376887 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000376887 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000376887 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000376887 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000376887 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENST00000376887 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENST00000376887 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENST00000376887 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENST00000376887 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1,4-bis(2-(3,5-dichloropyridyloxy))benzene
  • 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of ABCC4 protein
15986414
1,4-bis(2-(3,5-dichloropyridyloxy))benzene
  • 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of ABCC4 mRNA
15986414, 15833929
1,4-bis(2-(3,5-dichloropyridyloxy))benzene
  • [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased activity of NR1I3 protein] which results in increased expression of ABCC4 mRNA
15833929
2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein
  • Mefloquine inhibits the reaction [ABCC4 protein affects the export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
  • verlukast inhibits the reaction [ABCC4 protein affects the export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
16004972
8-azidoadenosine 5'-triphosphate
  • Silymarin does not affect the reaction [ABCC4 protein binds to 8-azidoadenosine 5'-triphosphate]
  • ABCC4 protein binds to 8-azidoadenosine 5'-triphosphate
  • Quercetin does not affect the reaction [ABCC4 protein binds to 8-azidoadenosine 5'-triphosphate]
16156793
Acetaminophen
  • Acetaminophen results in increased expression of ABCC4 mRNA
15496496
Acetaminophen
  • Acetaminophen results in increased expression of ABCC4 protein
16177239
Adenosine Triphosphate
  • ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate
  • Quercetin affects the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]
  • Quercetin inhibits the reaction [Alprostadil promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]]
  • Silymarin inhibits the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]
  • Silymarin inhibits the reaction [Alprostadil promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]]
  • daidzein promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]
  • hesperetin promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]
  • naringenin promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]
  • resveratrol promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]
16156793
Alprostadil
  • Quercetin inhibits the reaction [Alprostadil promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]]
  • Silymarin inhibits the reaction [Alprostadil promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]]
16156793
Bile Acids and Salts
  • ABCC4 protein affects the transport of Bile Acids and Salts
15841457
Butylated Hydroxyanisole
  • [Butylated Hydroxyanisole results in increased activity of NFE2L2 protein] which results in increased expression of ABCC4 mRNA
  • Butylated Hydroxyanisole results in increased expression of ABCC4 mRNA
15833929
calcein AM
  • Glutathione promotes the reaction [ABCC4 protein affects the transport of calcein AM]
15210835
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ABCC4 protein
17544377
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ABCC4 protein
16177239
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ABCC4 mRNA
15496496
Cyclic GMP
  • ABCC4 protein results in increased export of Cyclic GMP
  • Quercetin inhibits the reaction [ABCC4 protein results in increased export of Cyclic GMP]
  • Silymarin inhibits the reaction [ABCC4 protein results in increased export of Cyclic GMP]
  • daidzein inhibits the reaction [ABCC4 protein results in increased export of Cyclic GMP]
  • hesperetin inhibits the reaction [ABCC4 protein results in increased export of Cyclic GMP]
  • naringenin inhibits the reaction [ABCC4 protein results in increased export of Cyclic GMP]
  • resveratrol inhibits the reaction [ABCC4 protein results in increased export of Cyclic GMP]
16156793
daidzein
  • daidzein inhibits the reaction [ABCC4 protein results in increased export of Cyclic GMP]
  • daidzein promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]
16156793
Dipyridamole
  • Dipyridamole results in decreased activity of ABCC4 protein
15827327
Ethoxyquin
  • [Ethoxyquin results in increased activity of NFE2L2 protein] which results in increased expression of ABCC4 mRNA
  • Ethoxyquin results in increased expression of ABCC4 mRNA
15833929
Furosemide
  • ABCC4 protein results in increased export of Furosemide
17135398
Glutathione
  • ABCC4 protein affects the export of Glutathione
15845416
Glutathione
  • Glutathione promotes the reaction [ABCC4 protein affects the transport of calcein AM]
15210835
hesperetin
  • hesperetin inhibits the reaction [ABCC4 protein results in chemical resistance to Thioguanine]
  • hesperetin inhibits the reaction [ABCC4 protein results in increased export of Cyclic GMP]
  • hesperetin promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]
16156793
Hydrochlorothiazide
  • ABCC4 protein results in increased export of Hydrochlorothiazide
17135398
irinotecan
  • ABCC4 protein affects the export of irinotecan
15827327
Lithocholic Acid
  • Lithocholic Acid does not affect the expression of ABCC4 mRNA
12637555
Mefloquine
  • Mefloquine inhibits the reaction [ABCC4 protein affects the export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
  • Mefloquine inhibits the reaction [Prostaglandins E results in increased activity of ABCC4 protein]
  • Mefloquine inhibits the reaction [Quercetin results in increased activity of ABCC4 protein]
  • Mefloquine results in decreased activity of ABCC4 protein
16004972
Methotrexate
  • Uric Acid inhibits the reaction [ABCC4 protein affects the transport of Methotrexate]
15454390
Metribolone
  • Metribolone results in increased expression of ABCC4 mRNA
17010675
naringenin
  • naringenin inhibits the reaction [ABCC4 protein results in increased export of Cyclic GMP]
  • naringenin promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]
16156793
oltipraz
  • [oltipraz results in increased activity of NFE2L2 protein] which results in increased expression of ABCC4 mRNA
  • oltipraz results in increased expression of ABCC4 mRNA
15833929
Oncostatin M
  • Oncostatin M results in increased expression of ABCC4 mRNA
15654950
Paclitaxel
  • Paclitaxel results in increased expression of ABCC4 mRNA
15585946
Paraquat
  • Paraquat affects the expression of ABCC4 mRNA
16854511
Phenobarbital
  • Phenobarbital results in increased expression of ABCC4 mRNA
  • Phenobarbital results in increased expression of ABCC4 protein
15986414
pirinixic acid
  • pirinixic acid results in increased expression of ABCC4 mRNA
18301758
Prostaglandins E
  • Mefloquine inhibits the reaction [Prostaglandins E results in increased activity of ABCC4 protein]
  • verlukast inhibits the reaction [Prostaglandins E results in increased activity of ABCC4 protein]
16004972
Quercetin
  • ABCC4 protein results in chemical resistance to Quercetin
  • Quercetin affects the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]
  • Quercetin does not affect the reaction [ABCC4 protein binds to 8-azidoadenosine 5'-triphosphate]
  • Quercetin inhibits the reaction [ABCC4 protein results in chemical resistance to Thioguanine]
  • Quercetin inhibits the reaction [ABCC4 protein results in increased export of Cyclic GMP]
  • Quercetin inhibits the reaction [Alprostadil promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]]
16156793
Quercetin
  • Mefloquine inhibits the reaction [Quercetin results in increased activity of ABCC4 protein]
  • verlukast inhibits the reaction [Quercetin results in increased activity of ABCC4 protein]
16004972
resveratrol
  • ABCC4 protein results in chemical resistance to resveratrol
  • resveratrol inhibits the reaction [ABCC4 protein results in increased export of Cyclic GMP]
  • resveratrol promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]
16156793
Silymarin
  • Silymarin does not affect the reaction [ABCC4 protein binds to 8-azidoadenosine 5'-triphosphate]
  • Silymarin inhibits the reaction [ABCC4 protein results in increased export of Cyclic GMP]
  • Silymarin inhibits the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]
  • Silymarin inhibits the reaction [Alprostadil promotes the reaction [ABCC4 protein results in increased hydrolysis of Adenosine Triphosphate]]
16156793
sodium arsenate
  • sodium arsenate results in increased expression of ABCC4 mRNA
16882884
Thioguanine
  • Quercetin inhibits the reaction [ABCC4 protein results in chemical resistance to Thioguanine]
  • hesperetin inhibits the reaction [ABCC4 protein results in chemical resistance to Thioguanine]
  • verlukast inhibits the reaction [ABCC4 protein results in chemical resistance to Thioguanine]
16156793
Uric Acid
  • ABCC4 protein affects the export of Uric Acid
  • Uric Acid inhibits the reaction [ABCC4 protein affects the transport of Methotrexate]
15454390
verlukast
  • verlukast inhibits the reaction [ABCC4 protein results in chemical resistance to Thioguanine]
16156793
verlukast
  • verlukast inhibits the reaction [ABCC4 protein affects the export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
  • verlukast inhibits the reaction [Prostaglandins E results in increased activity of ABCC4 protein]
  • verlukast inhibits the reaction [Quercetin results in increased activity of ABCC4 protein]
  • verlukast results in decreased activity of ABCC4 protein
16004972
Zidovudine
  • Zidovudine results in increased expression of ABCC4 mRNA
  • ABCC4 protein results in increased export of Zidovudine
15456083

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Diabetes Mellitus, Type 1 inferred via Uric Acid 16506275
Neural Tube Defects inferred via sodium arsenate 11749123
Inflammation inferred via Silymarin 17213517
Liver Cirrhosis inferred via Silymarin 17213517
Liver Cirrhosis, Experimental inferred via Silymarin 15754394, 18277467, 15864749, 17198567
Liver Diseases inferred via Silymarin 17213517
Liver Diseases, Alcoholic inferred via Silymarin 17213517
Mushroom Poisoning inferred via Silymarin 17213517
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 16393696, 17534123
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17049120, 17935668, 17164350, 16490592, 16267019
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 16525036, 16317513, 16456233, 17015251, 17125593
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 17718901, 16731767, 17804756, 15767336, 17636462
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 16314181, 15827377, 16317513, 17520802
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Cadmium Poisoning inferred via Quercetin 16962696
Influenza, Human inferred via Quercetin 16624496
Kidney Diseases inferred via Quercetin 16962696
Liver Cirrhosis, Experimental inferred via Quercetin 12741479
Neurogenic Inflammation inferred via Quercetin 17929310
Pancreatic Neoplasms inferred via Quercetin 16965848
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Dystonia inferred via Phenobarbital 1851702
Epilepsy, Absence inferred via Phenobarbital 6401628
Liver Neoplasms inferred via Phenobarbital 15975961, 8742319
Myoclonic Epilepsies, Progressive inferred via Phenobarbital 17484760
Osteomalacia inferred via Phenobarbital 17016548
Pancreatic Neoplasms inferred via Phenobarbital 16965848
Pseudolymphoma inferred via Phenobarbital 12752131
Seizures, Febrile inferred via Phenobarbital 6407741
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 15824117, 11181820, 11445065, 16510128, 15451049, 11124998, 16140633
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Breast Neoplasms inferred via Paclitaxel 16244791, 11325840, 18323546, 15136595, 18234424
Carcinoma, Hepatocellular inferred via Paclitaxel 16313753
Liposarcoma inferred via Paclitaxel 17353645
Lymphoma, Non-Hodgkin inferred via Paclitaxel 14749477
Melanoma inferred via Paclitaxel 16342250, 12040289
Multiple Myeloma inferred via Paclitaxel 14749477
Ovarian Neoplasms inferred via Paclitaxel 11161223
Prostatic Neoplasms inferred via Paclitaxel 16356831, 17136230, 16729912
Liver Cirrhosis, Experimental inferred via oltipraz 16544323
Liver Cirrhosis, Experimental inferred via naringenin 14709902
Liver Diseases inferred via naringenin 16945181
Arthritis, Rheumatoid inferred via Methotrexate 17286800
Breast Neoplasms inferred via Methotrexate 16978400
Graft vs Host Disease inferred via Methotrexate 16518429
Liver Cirrhosis inferred via Methotrexate 14986274
Mucositis inferred via Methotrexate 17488658
Psoriasis inferred via Methotrexate 17410198
Colonic Neoplasms inferred via irinotecan 17725105
Colorectal Neoplasms inferred via irinotecan 16303861, 17454858, 18259882, 15273666
Neoplasm Metastasis inferred via irinotecan 18259882
Stomach Neoplasms inferred via irinotecan 15723263
Carcinoma, Squamous Cell inferred via Glutathione 17015178
Dyspnea inferred via Furosemide 16935035
Edema inferred via Furosemide 11834646
Heart Failure inferred via Furosemide 16011733, 16845234, 12660669
Hypercalcemia inferred via Furosemide 17652376
Hypercalciuria inferred via Furosemide 17652376
Hyperparathyroidism, Secondary inferred via Furosemide 15086907
Hypertension, Pregnancy-Induced inferred via Furosemide 16612254
Hypoproteinemia inferred via Furosemide 16096441
Nephrocalcinosis inferred via Furosemide 15086907
Nocturnal Enuresis inferred via Furosemide 17945291
Polyuria inferred via Furosemide 17945291
Reperfusion Injury inferred via Furosemide 16526316
Respiratory Distress Syndrome, Adult inferred via Furosemide 12394941, 15912074, 16096441
Stomach Neoplasms inferred via Furosemide 17052386
Cardiovascular Diseases inferred via daidzein 16332659
Diabetes Mellitus, Type 2 inferred via daidzein 16647724
Hypertension inferred via daidzein 17169123
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15673190, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048, 16050911
Fatty Liver inferred via Carbon Tetrachloride 16045604, 12795759, 61145, 12631006, 17595544, 15959796, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 15998439, 15027814, 15968718, 16227642, 16177239
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 16239168, 17334410
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17525996, 17557913, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17805973, 16248980, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 16116963, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 16964402, 17285989, 15830285
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17522070, 15968718, 16227642, 16177239, 14986274, 17562736
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Takeyama Y, et al. (2009) "Alternative transporter pathways in patients with untreated early-stage and late-stage primary biliary cirrhosis." Liver Int. 29(3):406-414. PMID:18662272
  2. [ + ] Chu XY, et al. (2009) "Metabolism and renal elimination of gaboxadol in humans: role of UDP-glucuronosyltransferases and transporters." Pharm Res. 26(2):459-468. PMID:19082692
  3. [ + ] Hoque MT, et al. (2009) "Involvement of NHERF1 in apical membrane localization of MRP4 in polarized kidney cells." Biochem Biophys Res Commun. 379(1):60-64. PMID:19073137
  4. [ + ] Rodriguez-Novoa S, et al. (2009) "Predictors of kidney tubular dysfunction in HIV-infected patients treated with tenofovir: a pharmacogenetic study." Clin Infect Dis. 48(11):e108-e116. PMID:19400747
  5. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  6. [ + ] van de Ven R, et al. (2008) "A role for multidrug resistance protein 4 (MRP4; ABCC4) in human dendritic cell migration." Blood. 112(6):2353-2359. PMID:18625884
  7. [ + ] El-Sheikh AA, et al. (2008) "Functional role of arginine 375 in transmembrane helix 6 of multidrug resistance protein 4 (MRP4/ABCC4)." Mol Pharmacol. 74(4):964-971. PMID:18612080
  8. [ + ] Abla N, et al. (2008) "The human multidrug resistance protein 4 (MRP4, ABCC4): functional analysis of a highly polymorphic gene." J Pharmacol Exp Ther. 325(3):859-868. PMID:18364470
  9. [ + ] Ho LL, et al. (2008) "Androgen regulation of multidrug resistance-associated protein 4 (MRP4/ABCC4) in prostate cancer." Prostate. 68(13):1421-1429. PMID:18615486
  10. [ + ] Gradhand U, et al. (2008) "Variability in human hepatic MRP4 expression: influence of cholestasis and genotype." Pharmacogenomics J. 8(1):42-52. PMID:17404579
  11. [ + ] Holla VR, et al. (2008) "Regulation of prostaglandin transporters in colorectal neoplasia." Cancer Prev Res (Phila Pa). 1(2):93-99. PMID:19138942
  12. [ + ] Gradilone A, et al. (2008) "Celecoxib upregulates multidrug resistance proteins in colon cancer: lack of synergy with standard chemotherapy." Curr Cancer Drug Targets. 8(5):414-420. PMID:18690847
  13. [ + ] Hosgood HD 3rd, et al. (2008) "Pathway-based evaluation of 380 candidate genes and lung cancer susceptibility suggests the importance of the cell cycle pathway." Carcinogenesis. 29(10):1938-1943. PMID:18676680
  14. [ + ] Sassi Y, et al. (2008) "Multidrug resistance-associated protein 4 regulates cAMP-dependent signaling pathways and controls human and rat SMC proliferation." J Clin Invest. 118(8):2747-2757. PMID:18636120
  15. [ + ] Rius M, et al. (2008) "ATP-dependent transport of leukotrienes B4 and C4 by the multidrug resistance protein ABCC4 (MRP4)." J Pharmacol Exp Ther. 324(1):86-94. PMID:17959747
  16. [ + ] de Wolf CJ, et al. (2007) "cGMP transport by vesicles from human and mouse erythrocytes." FEBS J. 274(2):439-450. PMID:17229149
  17. [ + ] Uchida Y, et al. (2007) "Multichannel liquid chromatography-tandem mass spectrometry cocktail method for comprehensive substrate characterization of multidrug resistance-associated protein 4 transporter." Pharm Res. 24(12):2281-2296. PMID:17939016
  18. [ + ] Murabito JM, et al. (2007) "A genome-wide association study of breast and prostate cancer in the NHLBI's Framingham Heart Study." BMC Med Genet. 8 Suppl 1():S6. PMID:17903305
  19. [ + ] Gradilone A, et al. (2007) "Celecoxib induces MRP-4 in lung cancer cells: therapeutic implications." J Clin Oncol. 25(27):4318-20; author reply 4320. PMID:17878487
  20. [ + ] Zollner G, et al. (2007) "Expression of bile acid synthesis and detoxification enzymes and the alternative bile acid efflux pump MRP4 in patients with primary biliary cirrhosis." Liver Int. 27(7):920-929. PMID:17696930
  21. [ + ] Mizuno N, et al. (2007) "Evaluation of the role of breast cancer resistance protein (BCRP/ABCG2) and multidrug resistance-associated protein 4 (MRP4/ABCC4) in the urinary excretion of sulfate and glucuronide metabolites of edaravone (MCI-186; 3-methyl-1-phenyl-2-pyrazolin-5-one)." Drug Metab Dispos. 35(11):2045-2052. PMID:17682070
  22. [ + ] Nozaki Y, et al. (2007) "Species difference in the inhibitory effect of nonsteroidal anti-inflammatory drugs on the uptake of methotrexate by human kidney slices." J Pharmacol Exp Ther. 322(3):1162-1170. PMID:17578901
  23. [ + ] Cai C, et al. (2007) "Androgen induces expression of the multidrug resistance protein gene MRP4 in prostate cancer cells." Prostate Cancer Prostatic Dis. 10(1):39-45. PMID:17003774
  24. [ + ] Li C, et al. (2007) "Spatiotemporal coupling of cAMP transporter to CFTR chloride channel function in the gut epithelia." Cell. 131(5):940-951. PMID:18045536
  25. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  26. [ + ] Rius M, et al. (2006) "Substrate specificity of human ABCC4 (MRP4)-mediated cotransport of bile acids and reduced glutathione." Am J Physiol Gastrointest Liver Physiol. 290(4):G640-G649. PMID:16282361
  27. [ + ] Anderson PL, et al. (2006) "Pharmacogenetic characteristics of indinavir, zidovudine, and lamivudine therapy in HIV-infected adults: a pilot study." J Acquir Immune Defic Syndr. 42(4):441-449. PMID:16791115
  28. [ + ] Izzedine H, et al. (2006) "Association between ABCC2 gene haplotypes and tenofovir-induced proximal tubulopathy." J Infect Dis. 194(11):1481-1491. PMID:17083032
  29. [ + ] Norris MD, et al. (2005) "Expression of multidrug transporter MRP4/ABCC4 is a marker of poor prognosis in neuroblastoma and confers resistance to irinotecan in vitro." Mol Cancer Ther. 4(4):547-553. PMID:15827327
  30. [ + ] Wu CP, et al. (2005) "Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5)." FEBS J. 272(18):4725-4740. PMID:16156793
  31. [ + ] Sauna ZE, et al. (2004) "Multidrug resistance protein 4 (ABCC4)-mediated ATP hydrolysis: effect of transport substrates and characterization of the post-hydrolysis transition state." J Biol Chem. 279(47):48855-48864. PMID:15364914
  32. [ + ] Jedlitschky G, et al. (2004) "The nucleotide transporter MRP4 (ABCC4) is highly expressed in human platelets and present in dense granules, indicating a role in mediator storage." Blood. 104(12):3603-3610. PMID:15297306
  33. [ + ] Bai J, et al. (2004) "Multidrug resistance protein 4 (MRP4/ABCC4) mediates efflux of bimane-glutathione." Int J Biochem Cell Biol. 36(2):247-257. PMID:14643890
  34. [ + ] Wielinga PR, et al. (2003) "Characterization of the MRP4- and MRP5-mediated transport of cyclic nucleotides from intact cells." J Biol Chem. 278(20):17664-17671. PMID:12637526
  35. [ + ] Lamba JK, et al. (2003) "Nonsense mediated decay downregulates conserved alternatively spliced ABCC4 transcripts bearing nonsense codons." Hum Mol Genet. 12(2):99-109. PMID:12499391
  36. [ + ] Zelcer N, et al. (2003) "Steroid and bile acid conjugates are substrates of human multidrug-resistance protein (MRP) 4 (ATP-binding cassette C4)." Biochem J. 371(Pt 2):361-367. PMID:12523936
  37. [ + ] Rius M, et al. (2003) "Cotransport of reduced glutathione with bile salts by MRP4 (ABCC4) localized to the basolateral hepatocyte membrane." Hepatology. 38(2):374-384. PMID:12883481
  38. [ + ] Reid G, et al. (2003) "The human multidrug resistance protein MRP4 functions as a prostaglandin efflux transporter and is inhibited by nonsteroidal antiinflammatory drugs." Proc Natl Acad Sci U S A. 100(16):9244-9249. PMID:12835412
  39. [ + ] Savaraj N, et al. (2003) "Overexpression of mutated MRP4 in cisplatin resistant small cell lung cancer cell line: collateral sensitivity to azidothymidine." Int J Oncol. 23(1):173-179. PMID:12792791
  40. [ + ] Reid G, et al. (2003) "Characterization of the transport of nucleoside analog drugs by the human multidrug resistance proteins MRP4 and MRP5." Mol Pharmacol. 63(5):1094-1103. PMID:12695538
  41. [ + ] Christian SL, et al. (2002) "An evaluation of the assembly of an approximately 15-Mb region on human chromosome 13q32-q33 linked to bipolar disorder and schizophrenia." Genomics. 79(5):635-656. PMID:11991713
  42. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  43. [ + ] Turriziani O, et al. (2002) "Impaired 2',3'-dideoxy-3'-thiacytidine accumulation in T-lymphoblastoid cells as a mechanism of acquired resistance independent of multidrug resistant protein 4 with a possible role for ATP-binding cassette C11." Biochem J. 368(Pt 1):325-332. PMID:12133003
  44. [ + ] Adachi M, et al. (2002) "Expression of MRP4 confers resistance to ganciclovir and compromises bystander cell killing." J Biol Chem. 277(41):38998-39004. PMID:12105214
  45. [ + ] van Aubel RA, et al. (2002) "The MRP4/ABCC4 gene encodes a novel apical organic anion transporter in human kidney proximal tubules: putative efflux pump for urinary cAMP and cGMP." J Am Soc Nephrol. 13(3):595-603. PMID:11856762
  46. [ + ] Schuetz JD, et al. (1999) "MRP4: A previously unidentified factor in resistance to nucleoside-based antiviral drugs." Nat Med. 5(9):1048-1051. PMID:10470083
  47. [ + ] Lee K, et al. (1998) "Isolation of MOAT-B, a widely expressed multidrug resistance-associated protein/canalicular multispecific organic anion transporter-related transporter." Cancer Res. 58(13):2741-2747. PMID:9661885
  48. [ + ] Kool M, et al. (1997) "Analysis of expression of cMOAT (MRP2), MRP3, MRP4, and MRP5, homologues of the multidrug resistance-associated protein gene (MRP1), in human cancer cell lines." Cancer Res. 57(16):3537-3547. PMID:9270026
  49. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702