AASS | GeneID:10157 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 10157 Official Symbol AASS
Locus N/A Gene Type protein-coding
Synonyms LKR/SDH; LKRSDH; LORSDH
Full Name aminoadipate-semialdehyde synthase
Description aminoadipate-semialdehyde synthase
Chromosome 7q31.3
Also Known As alpha-aminoadipate semialdehyde synthase; aminoadipic semialdehyde synthase; lysine-2-oxoglutarate reductase; lysine-ketoglutarate reductase /saccharopine dehydrogenase
Summary This gene encodes a bifunctional enzyme that catalyzes the first two steps in the mammalian lysine degradation pathway. The N-terminal and the C-terminal portions of this enzyme contain lysine-ketoglutarate reductase and saccharopine dehydrogenase activity, respectively, resulting in the conversion of lysine to alpha-aminoadipic semialdehyde. Mutations in this gene are associated with familial hyperlysinemia. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 4212

ID Symbol Protein Species
GeneID:10157 AASS NP_005754.2 Homo sapiens
GeneID:30956 Aass NP_038958.2 Mus musculus
GeneID:34064 CG7144 NP_609150.2 Drosophila melanogaster
GeneID:176842 dehydrogenase NP_499884.1 Caenorhabditis elegans
GeneID:296925 Aass XP_231524.4 Rattus norvegicus
GeneID:417757 AASS XP_416001.2 Gallus gallus
GeneID:472493 AASS XP_527868.2 Pan troglodytes
GeneID:482429 AASS XP_539546.2 Canis lupus familiaris
GeneID:520865 AASS XP_599115.3 Bos taurus
GeneID:556229 aass XP_684074.3 Danio rerio
GeneID:855786 LYS9 NP_014448.1 Saccharomyces cerevisiae
GeneID:1275481 AgaP_AGAP008632 XP_314728.2 Anopheles gambiae
GeneID:2540908 SPBC3B8.03 NP_596411.1 Schizosaccharomyces pombe
GeneID:2678741 MGG_08564 XP_362873.1 Magnaporthe grisea
GeneID:2704923 NCU03748.1 XP_323050.1 Neurospora crassa
GeneID:2892518 KLLA0C18744g XP_453035.1 Kluyveromyces lactis

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abgent AP2779c AASS Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
2 acris AP12425PU-N AASS (Center); antibody Ab

Exon, Intron and UTRs

Exon, Intron and UTRs of AASS Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AASS Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005739 Component mitochondrion
GO:0005488 Function binding
GO:0009055 Function electron carrier activity
GO:0016491 Function oxidoreductase activity
GO:0047131 Function saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity
GO:0047130 Function saccharopine dehydrogenase (NADP+, L-lysine-forming) activity
GO:0019477 Process L-lysine catabolic process
GO:0055114 Process oxidation reduction
GO:0051262 Process protein tetramerization

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005763  UCSC Browser NP_005754 A4D0W4   Q9UDR5  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000358954 MI0000103 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000358954 MI0000739 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000358954 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000358954 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000358954 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000358954 MI0000443 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000358954 MI0000444 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000358954 MI0000445 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000358954 MI0000471 hsa-miR-126* CAUUAUUACUUUUGGUACGCG
ENST00000358954 MI0000475 hsa-miR-136* CAUCAUCGUCUCAAAUGAGUCU
ENST00000358954 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENST00000358954 MI0000456 hsa-miR-140-5p CAGUGGUUUUACCCUAUGGUAG
ENST00000358954 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENST00000358954 MI0000253 hsa-miR-148a UCAGUGCACUACAGAACUUUGU
ENST00000358954 MI0000253 hsa-miR-148a* AAAGUUCUGAGACACUCCGACU
ENST00000358954 MI0000811 hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
ENST00000358954 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENST00000358954 MI0000480 hsa-miR-154* AAUCAUACACGGUUGACCUAUU
ENST00000358954 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000358954 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000358954 MI0000070 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000358954 MI0000115 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000358954 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENST00000358954 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENST00000358954 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENST00000358954 MI0000294 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000358954 MI0000295 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000358954 MI0000740 hsa-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU
ENST00000358954 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENST00000358954 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000358954 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENST00000358954 MI0005566 hsa-miR-374b* CUUAGCAGGUUGUAUUAUCAUU
ENST00000358954 MI0000785 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
ENST00000358954 MI0003675 hsa-miR-411 UAGUAGACCGUAUAGCGUACG
ENST00000358954 MI0001446 hsa-miR-424* CAAAACGUGAGGCGCUGCUAU
ENST00000358954 MI0003135 hsa-miR-495 AAACAAACAUGGUGCACUUCUU
ENST00000358954 MI0003183 hsa-miR-499-3p AACAUCACAGCAAGUCUGUGCU
ENST00000358954 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENST00000358954 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENST00000358954 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000358954 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000358954 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000358954 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000358954 MI0003516 hsa-miR-545 UCAGCAAACAUUUAUUGUGUGC
ENST00000358954 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000358954 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000358954 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENST00000358954 MI0003577 hsa-miR-570 CGAAAACAGCAAUUACCUUUGC
ENST00000358954 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENST00000358954 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENST00000358954 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENST00000358954 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENST00000358954 MI0003599 hsa-miR-589* UCAGAACAAAUGCCGGUUCCCAGA
ENST00000358954 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENST00000358954 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENST00000358954 MI0003678 hsa-miR-656 AAUAUUAUACAGUCAACCUCU
ENST00000358954 MI0003684 hsa-miR-660 UACCCAUUGCAUAUCGGAGUUG
ENST00000358954 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENST00000358954 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000358954 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000358954 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000358954 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000358954 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000358954 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000358954 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of AASS mRNA
17351261

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
HYPERLYSINEMIA marker
SACCHAROPINURIA marker
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 11677210, 15861022, 17681005, 17333356, 16919318, 16105132
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  2. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  3. [ + ] Scherer SW, et al. (2003) "Human chromosome 7: DNA sequence and biology." Science. 300(5620):767-772. PMID:12690205
  4. [ + ] Hillier LW, et al. (2003) "The DNA sequence of human chromosome 7." Nature. 424(6945):157-164. PMID:12853948
  5. [ + ] Sacksteder KA, et al. (2000) "Identification of the alpha-aminoadipic semialdehyde synthase gene, which is defective in familial hyperlysinemia." Am J Hum Genet. 66(6):1736-1743. PMID:10775527
  6. [ + ] Papes F, et al. (1999) "Lysine degradation through the saccharopine pathway in mammals: involvement of both bifunctional and monofunctional lysine-degrading enzymes in mouse." Biochem J. 344 Pt 2():555-563. PMID:10567240
  7. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  8. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548
  9. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298