ABI2 | GeneID:10152 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 10152 Official Symbol ABI2
Locus N/A Gene Type protein-coding
Synonyms ABI-2; ABI2B; AIP-1; AblBP3; SSH3BP2; argBPIA; argBPIB
Full Name abl interactor 2
Description abl interactor 2
Chromosome 2q33
Also Known As abl binding protein 3; abl-interacting protein 1 (SH3-containing protein); abl-interactor 2; abl-interactor protein 2b; arg protein tyrosine kinase-binding protein
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 4209

ID Symbol Protein Species
GeneID:10152 ABI2 NP_005750.4 Homo sapiens
GeneID:41718 Abi NP_001097785.1 Drosophila melanogaster
GeneID:175789 abi-1 NP_498224.1 Caenorhabditis elegans
GeneID:286928 Abi2 NP_775166.1 Rattus norvegicus
GeneID:329165 Abi2 NP_937760.1 Mus musculus
GeneID:424108 ABI2 XP_001232729.1 Gallus gallus
GeneID:459892 ABI2 XP_001173251.1 Pan troglodytes
GeneID:692331 zgc:136560 NP_001038762.1 Danio rerio
GeneID:1278655 AgaP_AGAP001046 XP_318274.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 scbt ABI2 ABI2 Antibody / ABI2 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABI2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABI2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005856 Component cytoskeleton
GO:0005829 Component cytosol
GO:0030175 Component filopodium
GO:0030027 Component lamellipodium
GO:0008093 Function cytoskeletal adaptor activity
GO:0003677 Function DNA binding
GO:0019900 Function kinase binding
GO:0017124 Function SH3 domain binding
GO:0005070 Function SH3/SH2 adaptor activity
GO:0008154 Process actin polymerization or depolymerization
GO:0016477 Process cell migration
GO:0006928 Process cell motion
GO:0007010 Process cytoskeleton organization
GO:0018108 Process peptidyl-tyrosine phosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005759  UCSC Browser NP_005750

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000261017 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENST00000261017 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000261017 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000261017 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000261017 MI0000475 hsa-miR-136 ACUCCAUUUGUUUUGAUGAUGGA
ENST00000261017 MI0000073 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENST00000261017 MI0000074 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000261017 MI0000075 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000261017 MI0000342 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENST00000261017 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000261017 MI0000285 hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENST00000261017 MI0000083 hsa-miR-26a-1* CCUAUUCUUGGUUACUUGCACG
ENST00000261017 MI0000088 hsa-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENST00000261017 MI0000749 hsa-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENST00000261017 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000261017 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENST00000261017 MI0001641 hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
ENST00000261017 MI0002468 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENST00000261017 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENST00000261017 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENST00000261017 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000261017 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000261017 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000261017 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENST00000261017 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENST00000261017 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENST00000261017 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENST00000261017 MI0000263 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000261017 MI0000264 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000261017 MI0000265 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000261017 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENST00000261017 MI0000095 hsa-miR-93* ACUGCUGAGCUAGCACUUCCCG
ENST00000261017 MI0005756 hsa-miR-934 UGUCUACUACUGGAGACACUGG
ENST00000261017 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENST00000261017 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENST00000261017 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000261017 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000261017 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000261017 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000261017 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENST00000261017 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENST00000261017 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENST00000261017 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENST00000261017 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABI2 mRNA
17562736
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ABI2 mRNA
17484886
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ABI2 mRNA
17557909

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 11677210, 15861022, 16105132, 17333356, 17681005, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048, 16050911, 15673190
Fatty Liver inferred via Carbon Tetrachloride 16045604, 16239168, 17595544, 12795759, 61145, 12631006, 15959796
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 16177239, 16227642, 15027814, 15968718, 15998439
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 17334410, 16239168, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 15925388, 16248980, 17525996, 17557913, 17805973, 16116963
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 15830285, 15720792, 17285989
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17562736, 17522070, 15968718, 16227642, 16081117, 14986274, 16177239
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABL1 ABL1 / ABI2 Affinity Capture-Western Cao C (2003)
ABL1 ABI2 / ABL1 Affinity Capture-Western Dai Z (1995)
ABL1 ABI2 / ABL1 Reconstituted Complex Dai Z (1995)
CGI-116 ABI2 / CGI-116 Two-hybrid Rual JF (2005)
IFT20 ABI2 / IFT20 Two-hybrid Rual JF (2005)
KRT15 KRT15 / ABI2 Two-hybrid Rual JF (2005)
KRT19 KRT19 / ABI2 Two-hybrid Rual JF (2005)
KRT20 ABI2 / KRT20 Two-hybrid Rual JF (2005)
NCK2 NCK2 / ABI2 Two-hybrid Rual JF (2005)
PCM1 PCM1 / ABI2 Two-hybrid Rual JF (2005)
SH3KBP1 SH3KBP1 / ABI2 Reconstituted Complex Chen B (2000)
SNAP23 SNAP23 / ABI2 Two-hybrid Rual JF (2005)
VCL VCL / ABI2 Two-hybrid Rual JF (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ryu JR, et al. (2009) "Regulation of cell-cell adhesion by Abi/Diaphanous complexes." Mol Cell Biol. 29(7):1735-1748. PMID:19158278
  2. [ + ] Kano S, et al. (2008) "Tripartite motif protein 32 facilitates cell growth and migration via degradation of Abl-interactor 2." Cancer Res. 68(14):5572-5580. PMID:18632609
  3. [ + ] O'Donnell CJ, et al. (2007) "Genome-wide association study for subclinical atherosclerosis in major arterial territories in the NHLBI's Framingham Heart Study." BMC Med Genet. 8 Suppl 1():S4. PMID:17903303
  4. [ + ] Li Y, et al. (2007) "Bcr-Abl induces abnormal cytoskeleton remodeling, beta1 integrin clustering and increased cell adhesion to fibronectin through the Abl interactor 1 pathway." J Cell Sci. 120(Pt 8):1436-1446. PMID:17389688
  5. [ + ] Luo X, et al. (2006) "The expression of Abl interactor 2 in leiomyoma and myometrium and regulation by GnRH analogue and transforming growth factor-beta." Hum Reprod. 21(6):1380-1386. PMID:16488906
  6. [ + ] Hirao N, et al. (2006) "NESH (Abi-3) is present in the Abi/WAVE complex but does not promote c-Abl-mediated phosphorylation." FEBS Lett. 580(27):6464-6470. PMID:17101133
  7. [ + ] Rual JF, et al. (2005) "Towards a proteome-scale map of the human protein-protein interaction network." Nature. 437(7062):1173-1178. PMID:16189514
  8. [ + ] Eastman SW, et al. (2005) "Identification of human VPS37C, a component of endosomal sorting complex required for transport-I important for viral budding." J Biol Chem. 280(1):628-636. PMID:15509564
  9. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  10. [ + ] Brandenberger R, et al. (2004) "Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation." Nat Biotechnol. 22(6):707-716. PMID:15146197
  11. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  12. [ + ] Cao C, et al. (2003) "Functional interaction between the c-Abl and Arg protein-tyrosine kinases in the oxidative stress response." J Biol Chem. 278(15):12961-12967. PMID:12569093
  13. [ + ] Ichigotani Y, et al. (2002) "In search of a function for the E3B1/Abi2/Argbp1/NESH family (Review)." Int J Mol Med. 9(6):591-595. PMID:12011975
  14. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  15. [ + ] Huang L, et al. (2002) "Screen and identification of proteins interacting with ADAM19 cytoplasmic tail." Mol Biol Rep. 29(3):317-323. PMID:12463424
  16. [ + ] Stradal T, et al. (2001) "The Abl interactor proteins localize to sites of actin polymerization at the tips of lamellipodia and filopodia." Curr Biol. 11(11):891-895. PMID:11516653
  17. [ + ] Courtney KD, et al. (2000) "Localization and phosphorylation of Abl-interactor proteins, Abi-1 and Abi-2, in the developing nervous system." Mol Cell Neurosci. 16(3):244-257. PMID:10995551
  18. [ + ] Machado RD, et al. (2000) "A physical and transcript map based upon refinement of the critical interval for PPH1, a gene for familial primary pulmonary hypertension. The International PPH Consortium." Genomics. 68(2):220-228. PMID:10964520
  19. [ + ] Chen B, et al. (2000) "The glioma-associated protein SETA interacts with AIP1/Alix and ALG-2 and modulates apoptosis in astrocytes." J Biol Chem. 275(25):19275-19281. PMID:10858458
  20. [ + ] Juang JL, et al. (1999) "Drosophila abelson interacting protein (dAbi) is a positive regulator of abelson tyrosine kinase activity." Oncogene. 18(37):5138-5147. PMID:10498863
  21. [ + ] Wang B, et al. (1996) "Identification of ArgBP1, an Arg protein tyrosine kinase binding protein that is the human homologue of a CNS-specific Xenopus gene." Oncogene. 12(9):1921-1929. PMID:8649853
  22. [ + ] Dai Z, et al. (1995) "Abi-2, a novel SH3-containing protein interacts with the c-Abl tyrosine kinase and modulates c-Abl transforming activity." Genes Dev. 9(21):2569-2582. PMID:7590236