HUWE1 | GeneID:10075 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 10075 Official Symbol HUWE1
Locus RP3-339A18.4 Gene Type protein-coding
Synonyms ARF-BP1; HECTH9; HSPC272; Ib772; KIAA0312; LASU1; MULE; UREB1
Full Name HECT, UBA and WWE domain containing 1
Description HECT, UBA and WWE domain containing 1
Chromosome Xp11.22
Also Known As ARF binding protein 1; BJ-HCC-24 tumor antigen; HECT domain protein LASU1; Mcl-1 ubiquitin ligase E3; OTTHUMP00000023356; OTTHUMP00000061860
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 45994

ID Symbol Protein Species
GeneID:10075 HUWE1 NP_113584.3 Homo sapiens
GeneID:32510 CG8184 NP_573059.1 Drosophila melanogaster
GeneID:59026 Huwe1 NP_067498.3 Mus musculus
GeneID:177084 eel-1 NP_500284.2 Caenorhabditis elegans
GeneID:480931 HUWE1 XP_538052.2 Canis lupus familiaris
GeneID:511826 HUWE1 XP_877960.2 Bos taurus
GeneID:559439 LOC559439 XP_001923899.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab70161 ARFBP1 antibody (ab70161); Rabbit polyclonal to ARFBP1
2 abcam ab65153 ARFBP1 antibody (ab65153); Rabbit polyclonal to ARFBP1
3 acris AP07305PU-N HUWE1 / UREB1; antibody Ab
4 scbt HUWE1 HUWE1 Antibody / HUWE1 Antibodies;
5 sigma HPA002548 Anti-HUWE1 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of HUWE1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of HUWE1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005622 Component intracellular
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0016881 Function acid-amino acid ligase activity
GO:0003677 Function DNA binding
GO:0016874 Function ligase activity
GO:0005515 Function protein binding
GO:0004842 Function ubiquitin-protein ligase activity
GO:0030154 Process cell differentiation
GO:0016574 Process histone ubiquitination
GO:0019941 Process modification-dependent protein catabolic process
GO:0006464 Process protein modification process
GO:0000209 Process protein polyubiquitination

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_031407  UCSC Browser NP_113584

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000262854 MI0000433 hsa-let-7g* CUGUACAGGCCACUGCCUUGC
ENST00000262854 MI0000472 hsa-miR-127-3p UCGGAUCCGUCUGAGCUUGGCU
ENST00000262854 MI0000809 hsa-miR-151-5p UCGAGGAGCUCACAGUCUAGU
ENST00000262854 MI0000438 hsa-miR-15b* CGAAUCAUUAUUUGCUGCUCUA
ENST00000262854 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENST00000262854 MI0000274 hsa-miR-187* GGCUACAACACAGGACCCGGGC
ENST00000262854 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENST00000262854 MI0001721 hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENST00000262854 MI0003820 hsa-miR-454* ACCCUAUCAAUAUUGUCUCUGC
ENST00000262854 MI0003190 hsa-miR-505 CGUCAACACUUGCUGGUUUCCU
ENST00000262854 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000262854 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000262854 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000262854 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000262854 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000262854 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENST00000262854 MI0003516 hsa-miR-545 UCAGCAAACAUUUAUUGUGUGC
ENST00000262854 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENST00000262854 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENST00000262854 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENST00000262854 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENST00000262854 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENST00000262854 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENST00000262854 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENST00000262854 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENST00000262854 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU
ENST00000342160 MI0000111 hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA
ENST00000342160 MI0000112 hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA
ENST00000342160 MI0000442 hsa-miR-122* AACGCCAUUAUCACACUAAAUA
ENST00000342160 MI0000472 hsa-miR-127-3p UCGGAUCCGUCUGAGCUUGGCU
ENST00000342160 MI0000438 hsa-miR-15b* CGAAUCAUUAUUUGCUGCUCUA
ENST00000342160 MI0000289 hsa-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENST00000342160 MI0000271 hsa-miR-181c* AACCAUCGACCGUUGAGUGGAC
ENST00000342160 MI0000742 hsa-miR-34b CAAUCACUAACUCCACUGCCAU
ENST00000342160 MI0000743 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG
ENST00000342160 MI0000786 hsa-miR-378* CUCCUGACUCCAGGUCCUGUGU
ENST00000342160 MI0003135 hsa-miR-495 AAACAAACAUGGUGCACUUCUU
ENST00000342160 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000342160 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000342160 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000342160 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000342160 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENST00000342160 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENST00000342160 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENST00000342160 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.2838G>T1
c.1442G>A1
Primary Site / Histology (Top 10)Mutations (sites * observations)
breast / carcinoma2

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Doxorubicin
  • Doxorubicin results in increased expression of HUWE1 mRNA
16404146

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
MENTAL RETARDATION, X-LINKED, SYNDROMIC 10 marker
MENTAL RETARDATION, X-LINKED, SYNDROMIC, TURNER TYPE marker
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 15939500, 17426702, 15668708, 16264153, 18234424, 17369602, 16935488, 18382427, 18628466, 16826403, 17983394, 15136595, 11325840, 16322301, 16096432, 15993339, 15634643, 15567936, 15994142
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 17876044, 16023760, 16234567
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 15811867, 17308081, 16651473, 17351982, 17131338, 16455267, 18627295, 17329180, 16731534, 17974986, 17382496, 15505089, 16278810, 15476868, 16269455, 16109756, 16242529, 16364871, 17007740
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16244371, 16330681, 16879835, 16244372, 16144979
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 15147373, 18501091
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 16729912, 16868541, 15749863, 18437689, 16888761
Sarcoma inferred via Doxorubicin 18313854, 17710206, 17203757, 15675481, 15625365, 16767912
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 15625365, 17203757
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Stankiewicz AR, et al. (2009) "Regulation of heat-induced apoptosis by Mcl-1 degradation and its inhibition by Hsp70." Cell Death Differ. 16(4):638-647. PMID:19148187
  2. [ + ] Horikawa Y, et al. (2008) "Single nucleotide polymorphisms of microRNA machinery genes modify the risk of renal cell carcinoma." Clin Cancer Res. 14(23):7956-7962. PMID:19047128
  3. [ + ] Herold S, et al. (2008) "Miz1 and HectH9 regulate the stability of the checkpoint protein, TopBP1." EMBO J. 27(21):2851-2861. PMID:18923429
  4. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  5. [ + ] Zhao X, et al. (2008) "The HECT-domain ubiquitin ligase Huwe1 controls neural differentiation and proliferation by destabilizing the N-Myc oncoprotein." Nat Cell Biol. 10(6):643-653. PMID:18488021
  6. [ + ] Froyen G, et al. (2008) "Submicroscopic duplications of the hydroxysteroid dehydrogenase HSD17B10 and the E3 ubiquitin ligase HUWE1 are associated with mental retardation." Am J Hum Genet. 82(2):432-443. PMID:18252223
  7. [ + ] Hall JR, et al. (2007) "Cdc6 stability is regulated by the Huwe1 ubiquitin ligase after DNA damage." Mol Biol Cell. 18(9):3340-3350. PMID:17567951
  8. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  9. [ + ] Beausoleil SA, et al. (2006) "A probability-based approach for high-throughput protein phosphorylation analysis and site localization." Nat Biotechnol. 24(10):1285-1292. PMID:16964243
  10. [ + ] Ross MT, et al. (2005) "The DNA sequence of the human X chromosome." Nature. 434(7031):325-337. PMID:15772651
  11. [ + ] Yoon SY, et al. (2005) "Over-expression of human UREB1 in colorectal cancer: HECT domain of human UREB1 inhibits the activity of tumor suppressor p53 protein." Biochem Biophys Res Commun. 326(1):7-17. PMID:15567145
  12. [ + ] Liu Z, et al. (2005) "Characterization of E3Histone, a novel testis ubiquitin protein ligase which ubiquitinates histones." Mol Cell Biol. 25(7):2819-2831. PMID:15767685
  13. [ + ] Chen D, et al. (2005) "ARF-BP1/Mule is a critical mediator of the ARF tumor suppressor." Cell. 121(7):1071-1083. PMID:15989956
  14. [ + ] Zhong Q, et al. (2005) "Mule/ARF-BP1, a BH3-only E3 ubiquitin ligase, catalyzes the polyubiquitination of Mcl-1 and regulates apoptosis." Cell. 121(7):1085-1095. PMID:15989957
  15. [ + ] Warr MR, et al. (2005) "BH3-ligand regulates access of MCL-1 to its E3 ligase." FEBS Lett. 579(25):5603-5608. PMID:16213503
  16. [ + ] Adhikary S, et al. (2005) "The ubiquitin ligase HectH9 regulates transcriptional activation by Myc and is essential for tumor cell proliferation." Cell. 123(3):409-421. PMID:16269333
  17. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  18. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  19. [ + ] Beausoleil SA, et al. (2004) "Large-scale characterization of HeLa cell nuclear phosphoproteins." Proc Natl Acad Sci U S A. 101(33):12130-12135. PMID:15302935
  20. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  21. [ + ] Zhang QH, et al. (2000) "Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells." Genome Res. 10(10):1546-1560. PMID:11042152
  22. [ + ] Nagase T, et al. (2000) "Prediction of the coding sequences of unidentified human genes. XVIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro." DNA Res. 7(4):273-281. PMID:10997877
  23. [ + ] Jackson PK, et al. (2000) "The lore of the RINGs: substrate recognition and catalysis by ubiquitin ligases." Trends Cell Biol. 10(10):429-439. PMID:10998601
  24. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  25. [ + ] Nagase T, et al. (1997) "Prediction of the coding sequences of unidentified human genes. VII. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro." DNA Res. 4(2):141-150. PMID:9205841
  26. [ + ] Gu J, et al. (1995) "UREB1, a tyrosine phosphorylated nuclear protein, inhibits p53 transactivation." Oncogene. 11(10):2175-2178. PMID:7478539
  27. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298
  28. [ + ] Gu J, et al. (1994) "Cloning of a DNA binding protein that is a tyrosine kinase substrate and recognizes an upstream initiator-like sequence in the promoter of the preprodynorphin gene." Brain Res Mol Brain Res. 24(1-4):77-88. PMID:7968380