ABCF2 | GeneID:10061 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 10061 Official Symbol ABCF2
Locus N/A Gene Type protein-coding
Synonyms ABC28; DKFZp586K1823; EST133090; HUSSY-18; HUSSY18; M-ABC1
Full Name ATP-binding cassette, sub-family F (GCN20), member 2
Description ATP-binding cassette, sub-family F (GCN20), member 2
Chromosome 7q36
Also Known As ABC-type transport protein; ATP-binding cassette, sub-family F, member 2; Iron inhibited ABC transporter 2
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This protein is a member of the GCN20 subfamily. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21408

ID Symbol Protein Species
GeneID:10061 ABCF2 NP_005683.2 Homo sapiens
GeneID:27407 Abcf2 NP_038881.1 Mus musculus
GeneID:32508 CG9281 NP_573057.1 Drosophila melanogaster
GeneID:176771 abcf-2 NP_499779.1 Caenorhabditis elegans
GeneID:311959 Abcf2 XP_231307.1 Rattus norvegicus
GeneID:336770 abcf2 NP_958472.1 Danio rerio
GeneID:426038 ABCF2 NP_001006562.1 Gallus gallus
GeneID:463887 ABCF2 XP_001139777.1 Pan troglodytes
GeneID:482806 ABCF2 XP_850220.1 Canis lupus familiaris
GeneID:513061 ABCF2 NP_001039601.1 Bos taurus
GeneID:836200 ATGCN1 NP_200887.1 Arabidopsis thaliana
GeneID:1273267 AgaP_AGAP002693 XP_312228.2 Anopheles gambiae
GeneID:4346343 Os08g0564100 NP_001062528.1 Oryza sativa
GeneID:4347924 Os09g0572400 NP_001063997.1 Oryza sativa
GeneID:100000576 LOC100000576 XP_001337123.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab56790 ABCF2 antibody (ab56790); Mouse monoclonal to ABCF2
2 abcam ab50807 ABCF2 antibody [2001C1] (ab50807); Mouse monoclonal [2001C1] to ABCF2
3 abnova H00010061-M01 ABCF2 monoclonal antibody (M01), clone 1D11; Mouse monoclonal antibody raised against a partial recombinant ABCF2.
4 scbt ABCF2 ABCF2 Antibody / ABCF2 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCF2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCF2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0043190 Component ATP-binding cassette (ABC) transporter complex
GO:0005740 Component mitochondrial envelope
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005215 Function transporter activity
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005692  UCSC Browser NP_005683 Q75MJ1   Q9UG63  
2 NM_007189  UCSC Browser NP_009120 Q75MJ0   Q9UG63  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000222388 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000222388 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000222388 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENST00000222388 MI0000455 hsa-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENST00000222388 MI0000476 hsa-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENST00000222388 MI0000261 hsa-miR-139-3p GGAGACGCGGCCCUGUUGGAGU
ENST00000222388 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000222388 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000222388 MI0000070 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000222388 MI0000115 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000222388 MI0000489 hsa-miR-195 UAGCAGCACAGAAAUAUUGGC
ENST00000222388 MI0000650 hsa-miR-200c* CGUCUUACCCAGCAGUGUUUGG
ENST00000222388 MI0000294 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000222388 MI0000295 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000222388 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENST00000222388 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENST00000222388 MI0000805 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENST00000222388 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENST00000222388 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENST00000222388 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENST00000222388 MI0003675 hsa-miR-411 UAGUAGACCGUAUAGCGUACG
ENST00000222388 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENST00000222388 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENST00000222388 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENST00000222388 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENST00000222388 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000222388 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000222388 MI0003138 hsa-miR-497 CAGCAGCACACUGUGGUUUGU
ENST00000222388 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000222388 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000222388 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000222388 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000222388 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000222388 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENST00000222388 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENST00000222388 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENST00000222388 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENST00000222388 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENST00000222388 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENST00000222388 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENST00000222388 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENST00000222388 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENST00000222388 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENST00000222388 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENST00000222388 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENST00000222388 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENST00000222388 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENST00000222388 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENST00000222388 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENST00000222388 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENST00000222388 MI0004601 mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG
ENST00000222388 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENST00000222388 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENST00000222388 MI0004677 mmu-miR-696 GCGUGUGCUUGCUGUGGG
ENST00000222388 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENST00000222388 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENST00000222388 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENST00000222388 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU
ENST00000287844 MI0000449 hsa-miR-132* ACCGUGGCUUUCGAUUGUUACU
ENST00000287844 MI0000289 hsa-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENST00000287844 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENST00000287844 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENST00000287844 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABCF2 mRNA
17562736
Clofibric Acid
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCF2 mRNA
17602206
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCF2 mRNA
17602206
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ABCF2 mRNA
17555576
Tamoxifen
  • Tamoxifen affects the expression of ABCF2 mRNA
17555576
Uranium
  • Uranium affects the expression of ABCF2 mRNA
15672453
uranyl acetate
  • uranyl acetate affects the expression of ABCF2 mRNA
15672453

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms inferred via Tamoxifen 16202921, 17242785, 16818667, 17049068, 17893378, 15668708, 17440819, 17261762, 16873071, 11161223, 15565566
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 16827153, 14580682
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 15861022, 11677210, 16105132, 16919318, 17333356, 17681005
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 11831363, 10672840, 10737359, 17428255
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 12112319, 10737359, 18648771, 16942905, 15885732
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 16842330, 3124819
Liver Neoplasms inferred via Clofibric Acid 17602206
Hepatitis, Toxic inferred via Acetaminophen 2444490, 15968718, 17522070, 17562736, 14986274, 16227642, 16177239, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Nishimura S, et al. (2008) "Can ABCF2 protein expression predict the prognosis of uterine cancer?" Br J Cancer. 99(10):1651-1655. PMID:19002184
  3. [ + ] Nishimura S, et al. (2007) "Differential expression of ABCF2 protein among different histologic types of epithelial ovarian cancer and in clear cell adenocarcinomas of different organs." Hum Pathol. 38(1):134-139. PMID:16996567
  4. [ + ] Tsuda H, et al. (2005) "Identification of overexpression and amplification of ABCF2 in clear cell ovarian adenocarcinomas by cDNA microarray analyses." Clin Cancer Res. 11(19 Pt 1):6880-6888. PMID:16203778
  5. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  6. [ + ] Scherer SW, et al. (2003) "Human chromosome 7: DNA sequence and biology." Science. 300(5620):767-772. PMID:12690205
  7. [ + ] Hillier LW, et al. (2003) "The DNA sequence of human chromosome 7." Nature. 424(6945):157-164. PMID:12853948
  8. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  9. [ + ] Stanchi F, et al. (2001) "Characterization of 16 novel human genes showing high similarity to yeast sequences." Yeast. 18(1):69-80. PMID:11124703
  10. [ + ] Dean M, et al. (2001) "The human ATP-binding cassette (ABC) transporter superfamily." Genome Res. 11(7):1156-1166. PMID:11435397
  11. [ + ] Ye Z, et al. (2000) "cDNA cloning by amplification of circularized first strand cDNAs reveals non-IRE-regulated iron-responsive mRNAs." Biochem Biophys Res Commun. 275(1):223-227. PMID:10944468
  12. [ + ] Zhang F, et al. (2000) "M-ABC2, a new human mitochondrial ATP-binding cassette membrane protein." FEBS Lett. 478(1-2):89-94. PMID:10922475
  13. [ + ] Hogue DL, et al. (1999) "Identification and characterization of a mammalian mitochondrial ATP-binding cassette membrane protein." J Mol Biol. 285(1):379-389. PMID:9878413
  14. [ + ] Klein I, et al. (1999) "An inventory of the human ABC proteins." Biochim Biophys Acta. 1461(2):237-262. PMID:10581359
  15. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702