ABCC9 | GeneID:10060 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 10060 Official Symbol ABCC9
Locus N/A Gene Type protein-coding
Synonyms ABC37; CMD1O; FLJ36852; SUR2
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Chromosome 12p12.1
Also Known As ATP-binding cassette, sub-family C, member 9; sulfonylurea receptor 2A
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein is thought to form ATP-sensitive potassium channels in cardiac, skeletal, and vascular and non-vascular smooth muscle. Protein structure suggests a role as the drug-binding channel-modulating subunit of the extrapancreatic ATP-sensitive potassium channels. No disease has been associated with this gene thus far. Alternative splicing of this gene results in several products, two of which result from differential usage of two terminal exons and one of which results from exon deletion. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56521

ID Symbol Protein Species
GeneID:10060 ABCC9 NP_064693.2 Homo sapiens
GeneID:20928 Abcc9 NP_035641.1 Mus musculus
GeneID:25560 Abcc9 NP_037172.2 Rattus norvegicus
GeneID:34350 Sur NP_477472.1 Drosophila melanogaster
GeneID:465338 ABCC9 XP_001149571.1 Pan troglodytes
GeneID:486638 ABCC9 XP_852746.1 Canis lupus familiaris
GeneID:522913 ABCC9 XP_601202.3 Bos taurus
GeneID:561160 abcc9 NP_001025325.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 scbt ABCC9 ABCC9 Antibody / ABCC9 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCC9 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCC9 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0008282 Component ATP-sensitive potassium channel complex
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0015459 Function potassium channel regulator activity
GO:0004872 Function receptor activity
GO:0008281 Function sulfonylurea receptor activity
GO:0005215 Function transporter activity
GO:0051607 Process defense response to virus
GO:0010107 Process potassium ion import
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005691  UCSC Browser NP_005682
2 NM_020297  UCSC Browser NP_064693
3 NM_020298  UCSC Browser NP_064694

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000261200 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENST00000261200 MI0000480 hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENST00000261200 MI0000342 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENST00000261200 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000261200 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENST00000261200 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENST00000261200 MI0001641 hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
ENST00000261200 MI0001733 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA
ENST00000261200 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000261200 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000261200 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000261200 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENST00000261200 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENST00000261200 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENST00000261200 MI0003613 hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC
ENST00000261200 MI0003639 hsa-miR-625* GACUAUAGAACUUUCCCCCUCA
ENST00000261200 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENST00000261200 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENST00000261200 MI0005470 mmu-miR-743b-3p GAAAGACAUCAUGCUGAAUAGA
ENST00000261201 MI0000442 hsa-miR-122* AACGCCAUUAUCACACUAAAUA
ENST00000261201 MI0000457 hsa-miR-141* CAUCUUCCAGUACAGUGUUGGA
ENST00000261201 MI0000070 hsa-miR-16-1* CCAGUAUUAACUGUGCUGCUGA
ENST00000261201 MI0000083 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000261201 MI0000750 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000261201 MI0000084 hsa-miR-26b UUCAAGUAAUUCAGGAUAGGU
ENST00000261201 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENST00000261201 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENST00000261201 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENST00000261201 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENST00000261201 MI0003587 hsa-miR-580 UUGAGAAUGAUGAAUCAUUAGG
ENST00000261201 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000261201 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000261201 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000261201 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000261201 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABCC9 mRNA
17562736
bisphenol A
  • bisphenol A results in increased expression of ABCC9 mRNA
15901920
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ABCC9 mRNA
17484886
dicyclanil
  • dicyclanil results in decreased expression of ABCC9 mRNA
15664270
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of ABCC9 mRNA
15901920
Genistein
  • Genistein results in increased expression of ABCC9 mRNA
15901920
Glyburide
  • resveratrol inhibits the reaction [Glyburide binds to ABCC9 protein]
17138562
Glyburide
  • Glyburide binds to and results in decreased activity of ABCC9 protein
15652236
Paraquat
  • Paraquat affects the expression of ABCC9 mRNA
16854511
resveratrol
  • resveratrol binds to ABCC9 protein
  • resveratrol inhibits the reaction [Glyburide binds to ABCC9 protein]
17138562

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Cardiomyopathy, Dilated marker
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17164350, 16267019, 16490592, 17049120, 17935668
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 16317513, 16456233, 16525036, 17015251, 17125593
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 16731767, 17718901, 17636462, 17804756, 15767336
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 17520802, 16314181, 15827377, 16317513
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 15824117, 11445065, 11124998, 16140633, 11181820, 16510128, 15451049
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Neurotoxicity Syndromes inferred via Glyburide 16725203
Breast Neoplasms inferred via Genistein 17200150, 16541309, 16873071
Carcinoma, Hepatocellular inferred via Genistein 16924424
Cardiovascular Diseases inferred via Genistein 16332659
Colonic Neoplasms inferred via Genistein 17182828
Diabetes Mellitus, Type 2 inferred via Genistein 16647724
Endometrial Hyperplasia inferred via Genistein 16402032
Glioblastoma inferred via Genistein 16598420
Liver Cirrhosis, Experimental inferred via Genistein 17823541
Mammary Neoplasms, Experimental inferred via Genistein 14578162, 12929590
Myocardial Infarction inferred via Genistein 17141266
Myocardial Reperfusion Injury inferred via Genistein 17141266
Osteoporosis, Postmenopausal inferred via Genistein 16169203
Prostatic Neoplasms inferred via Genistein 16925846, 15378649, 15256057
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 11677210, 15861022, 16919318, 17681005, 17333356, 16105132
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16124888, 16227642, 15700767, 10355542, 15673190, 16097048, 16050911, 16011737
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 16239168, 12795759, 61145, 12631006, 17595544
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 15998439, 15027814, 15968718, 16227642, 16177239
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 17334410, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17557913, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 17805973, 16116963, 15925388, 16248980, 17525996
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 17285989, 15830285, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Breast Neoplasms inferred via bisphenol A 17123778
Carcinoma in Situ inferred via bisphenol A 17123778
Insulin Resistance inferred via bisphenol A 16393666
Prostatic Neoplasms inferred via bisphenol A 16740699
Substance-Related Disorders inferred via bisphenol A 16684133, 16045194
Uterine Diseases inferred via bisphenol A 14652134
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 15968718, 16227642, 16177239, 14986274, 17562736, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
EEF1G EEF1G / ABCC9 Two-hybrid Rual JF (2005)
LDHA LDHA / ABCC9 Affinity Capture-Western Crawford RM (2002)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Burke MA, et al. (2008) "The sulfonylurea receptor, an atypical ATP-binding cassette protein, and its regulation of the KATP channel." Circ Res. 102(2):164-176. PMID:18239147
  3. [ + ] Jiao J, et al. (2008) "Protein kinase C-epsilon induces caveolin-dependent internalization of vascular adenosine 5'-triphosphate-sensitive K+ channels." Hypertension. 52(3):499-506. PMID:18663158
  4. [ + ] Ploug KB, et al. (2008) "K ATP channels in pig and human intracranial arteries." Eur J Pharmacol. 601(1-3):43-49. PMID:18996111
  5. [ + ] Croker B, et al. (2007) "ATP-sensitive potassium channels mediate survival during infection in mammals and insects." Nat Genet. 39(12):1453-1460. PMID:18026101
  6. [ + ] Jons T, et al. (2006) "K+-ATP-channel-related protein complexes: potential transducers in the regulation of epithelial tight junction permeability." J Cell Sci. 119(Pt 15):3087-3097. PMID:16820413
  7. [ + ] Kang Y, et al. (2006) "Syntaxin-1A actions on sulfonylurea receptor 2A can block acidic pH-induced cardiac K(ATP) channel activation." J Biol Chem. 281(28):19019-19028. PMID:16672225
  8. [ + ] Minoretti P, et al. (2006) "A novel Val734Ile variant in the ABCC9 gene associated with myocardial infarction." Clin Chim Acta. 370(1-2):124-128. PMID:16563363
  9. [ + ] Sato N, et al. (2006) "A haplotype in the human Sur2 gene is associated with essential hypertension." J Hum Hypertens. 20(1):87-90. PMID:16267564
  10. [ + ] Rual JF, et al. (2005) "Towards a proteome-scale map of the human protein-protein interaction network." Nature. 437(7062):1173-1178. PMID:16189514
  11. [ + ] Kang Y, et al. (2004) "Syntaxin-1A inhibits cardiac KATP channels by its actions on nucleotide binding folds 1 and 2 of sulfonylurea receptor 2A." J Biol Chem. 279(45):47125-47131. PMID:15339904
  12. [ + ] Bienengraeber M, et al. (2004) "ABCC9 mutations identified in human dilated cardiomyopathy disrupt catalytic KATP channel gating." Nat Genet. 36(4):382-387. PMID:15034580
  13. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  14. [ + ] Singh H, et al. (2003) "Distribution of Kir6.0 and SUR2 ATP-sensitive potassium channel subunits in isolated ventricular myocytes." J Mol Cell Cardiol. 35(5):445-459. PMID:12738227
  15. [ + ] Insuk SO, et al. (2003) "Molecular basis and characteristics of KATP channel in human corporal smooth muscle cells." Int J Impot Res. 15(4):258-266. PMID:12934053
  16. [ + ] Curley M, et al. (2002) "Expression of mRNA transcripts for ATP-sensitive potassium channels in human myometrium." Mol Hum Reprod. 8(10):941-945. PMID:12356945
  17. [ + ] Giblin JP, et al. (2002) "Assembly limits the pharmacological complexity of ATP-sensitive potassium channels." J Biol Chem. 277(16):13717-13723. PMID:11825905
  18. [ + ] Wistow G, et al. (2002) "Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over 6000 non-redundant transcripts, novel genes and splice variants." Mol Vis. 8():205-220. PMID:12107410
  19. [ + ] Crawford RM, et al. (2002) "M-LDH serves as a sarcolemmal K(ATP) channel subunit essential for cell protection against ischemia." EMBO J. 21(15):3936-3948. PMID:12145195
  20. [ + ] Surapureddi S, et al. (2002) "Identification of a transcriptionally active peroxisome proliferator-activated receptor alpha -interacting cofactor complex in rat liver and characterization of PRIC285 as a coactivator." Proc Natl Acad Sci U S A. 99(18):11836-11841. PMID:12189208
  21. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  22. [ + ] Cui Y, et al. (2001) "A mechanism for ATP-sensitive potassium channel diversity: Functional coassembly of two pore-forming subunits." Proc Natl Acad Sci U S A. 98(2):729-734. PMID:11136227
  23. [ + ] Davis-Taber R, et al. (2000) "Molecular characterization of human SUR2-containing K(ATP) channels." Gene. 256(1-2):261-270. PMID:11054556
  24. [ + ] Kono Y, et al. (2000) "The properties of the Kir6.1-6.2 tandem channel co-expressed with SUR2A." Pflugers Arch. 440(5):692-698. PMID:11007308
  25. [ + ] Babenko AP, et al. (2000) "Pharmaco-topology of sulfonylurea receptors. Separate domains of the regulatory subunits of K(ATP) channel isoforms are required for selective interaction with K(+) channel openers." J Biol Chem. 275(2):717-720. PMID:10625598
  26. [ + ] Uhde I, et al. (1999) "Identification of the potassium channel opener site on sulfonylurea receptors." J Biol Chem. 274(40):28079-28082. PMID:10497157
  27. [ + ] Meyer M, et al. (1999) "Structural requirements of sulphonylureas and analogues for interaction with sulphonylurea receptor subtypes." Br J Pharmacol. 128(1):27-34. PMID:10498831
  28. [ + ] Lorenz E, et al. (1999) "Physical association between recombinant cardiac ATP-sensitive K+ channel subunits Kir6.2 and SUR2A." J Mol Cell Cardiol. 31(2):425-434. PMID:10093054
  29. [ + ] Shindo T, et al. (1998) "SUR2 subtype (A and B)-dependent differential activation of the cloned ATP-sensitive K+ channels by pinacidil and nicorandil." Br J Pharmacol. 124(5):985-991. PMID:9692785
  30. [ + ] Schwanstecher M, et al. (1998) "Potassium channel openers require ATP to bind to and act through sulfonylurea receptors." EMBO J. 17(19):5529-5535. PMID:9755153
  31. [ + ] Satoh E, et al. (1998) "Intracellular nucleotide-mediated gating of SUR/Kir6.0 complex potassium channels expressed in a mammalian cell line and its modification by pinacidil." J Physiol. 511 ( Pt 3)():663-674. PMID:9714850
  32. [ + ] Aguilar-Bryan L, et al. (1998) "Toward understanding the assembly and structure of KATP channels." Physiol Rev. 78(1):227-245. PMID:9457174
  33. [ + ] Chutkow WA, et al. (1996) "Cloning, tissue expression, and chromosomal localization of SUR2, the putative drug-binding subunit of cardiac, skeletal muscle, and vascular KATP channels." Diabetes. 45(10):1439-1445. PMID:8826984
  34. [ + ] Inagaki N, et al. (1996) "A family of sulfonylurea receptors determines the pharmacological properties of ATP-sensitive K+ channels." Neuron. 16(5):1011-1017. PMID:8630239