ABCB6 | GeneID:10058 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 10058 Official Symbol ABCB6
Locus N/A Gene Type protein-coding
Synonyms ABC; ABC14; EST45597; FLJ22414; MTABC3; PRP; umat
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 6
Description ATP-binding cassette, sub-family B (MDR/TAP), member 6
Chromosome 2q36
Also Known As ATP-binding cassette half-transporter; ATP-binding cassette, sub-family B, member 6
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This half-transporter likely plays a role in mitochondrial function. Localized to 2q26, this gene is considered a candidate gene for lethal neonatal metabolic syndrome, a disorder of mitochondrial function. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11375

ID Symbol Protein Species
GeneID:10058 ABCB6 NP_005680.1 Homo sapiens
GeneID:41925 CG4225 NP_650503.1 Drosophila melanogaster
GeneID:74104 Abcb6 NP_076221.1 Mus musculus
GeneID:140669 Abcb6 NP_542149.1 Rattus norvegicus
GeneID:176540 hmt-1 NP_001022812.1 Caenorhabditis elegans
GeneID:459959 ABCB6 XP_001161097.1 Pan troglodytes
GeneID:478914 ABCB6 XP_536073.2 Canis lupus familiaris
GeneID:564067 abcb6 XP_692515.3 Danio rerio
GeneID:783257 ABCB6 XP_001251072.1 Bos taurus
GeneID:812037 PF14_0455 XP_001348629.1 Plasmodium falciparum
GeneID:1269280 AgaP_AGAP002278 XP_307900.2 Anopheles gambiae
GeneID:2675723 MGG_05190 XP_359587.2 Magnaporthe grisea
GeneID:2704167 NCU00010.1 XP_322096.1 Neurospora crassa
GeneID:3361134 hmt1 NP_588371.2 Schizosaccharomyces pombe

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab47837 ABCB6 antibody (ab47837); Rabbit polyclonal to ABCB6
2 abgent AP6113a ABCB6 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
3 acris AP09332PU-N ABCB6 (aa 440-455); antibody Ab
4 acris AP13076PU-N ABCB6 (C-term); antibody Ab

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCB6 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCB6 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0043190 Component ATP-binding cassette (ABC) transporter complex
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005740 Component mitochondrial envelope
GO:0005741 Component mitochondrial outer membrane
GO:0005739 Component mitochondrion
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006879 Process cellular iron ion homeostasis
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005689  UCSC Browser NP_005680

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000265316 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000265316 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000265316 MI0000446 hsa-miR-125b-1* ACGGGUUAGGCUCUUGGGAGCU
ENST00000265316 MI0000261 hsa-miR-139-3p GGAGACGCGGCCCUGUUGGAGU
ENST00000265316 MI0000483 hsa-miR-186* GCCCAAAGGUGAAUUUUUUGGG
ENST00000265316 MI0000284 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENST00000265316 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENST00000265316 MI0000087 hsa-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENST00000265316 MI0000105 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000265316 MI0000107 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000265316 MI0000735 hsa-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENST00000265316 MI0000743 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG
ENST00000265316 MI0001448 hsa-miR-425* AUCGGGAAUGUCGUGUCCGCCC
ENST00000265316 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC
ENST00000265316 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000265316 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000265316 MI0003145 hsa-miR-519e* UUCUCCAAAAGGGAGCACUUUC
ENST00000265316 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENST00000265316 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENST00000265316 MI0003638 hsa-miR-624* UAGUACCAGUACCUUGUGUUCA
ENST00000265316 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENST00000265316 MI0005118 hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA
ENST00000265316 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENST00000265316 MI0003518 mmu-miR-540-5p CAAGGGUCACCCUCUGACUCUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABCB6 mRNA
17562736
coproporphyrinogen III
  • ABCB6 protein binds to and affects the transport of coproporphyrinogen III
17006453
glycidamide
  • glycidamide results in increased expression of ABCB6 mRNA
17822822
Heme
  • Heme results in increased expression of ABCB6 mRNA
  • Heme results in increased expression of ABCB6 protein
  • Heme results in increased expression of ABCB6 mRNA
  • Heme results in increased expression of ABCB6 protein
17006453
nitrosobenzylmethylamine
  • nitrosobenzylmethylamine results in decreased expression of ABCB6 mRNA
17616710
Phenobarbital
  • Phenobarbital results in increased expression of ABCB6 mRNA
12082028
pirinixic acid
  • pirinixic acid results in increased expression of ABCB6 mRNA
17426115

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Dystonia inferred via Phenobarbital 1851702
Epilepsy, Absence inferred via Phenobarbital 6401628
Liver Neoplasms inferred via Phenobarbital 15975961, 8742319
Myoclonic Epilepsies, Progressive inferred via Phenobarbital 17484760
Osteomalacia inferred via Phenobarbital 17016548
Pancreatic Neoplasms inferred via Phenobarbital 16965848
Pseudolymphoma inferred via Phenobarbital 12752131
Seizures, Febrile inferred via Phenobarbital 6407741
Esophageal Neoplasms inferred via nitrosobenzylmethylamine 16805852, 15264214, 15623463, 15150132, 15547721, 15878914, 16510608, 15547733, 16704527
Stomach Neoplasms inferred via nitrosobenzylmethylamine 17575124, 12958204
Inflammation inferred via Heme 12649161
Wounds and Injuries inferred via Heme 12649161
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 16081117, 14986274, 16227642, 15968718, 16177239, 17562736
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Tsuchida M, et al. (2008) "Human ABC transporter isoform B6 (ABCB6) localizes primarily in the Golgi apparatus." Biochem Biophys Res Commun. 369(2):369-375. PMID:18279659
  3. [ + ] Paterson JK, et al. (2007) "Human ABCB6 localizes to both the outer mitochondrial membrane and the plasma membrane." Biochemistry. 46(33):9443-9452. PMID:17661442
  4. [ + ] Kurashima-Ito K, et al. (2006) "Heteronuclear multidimensional NMR and homology modelling studies of the C-terminal nucleotide-binding domain of the human mitochondrial ABC transporter ABCB6." J Biomol NMR. 35(1):53-71. PMID:16791740
  5. [ + ] Krishnamurthy PC, et al. (2006) "Identification of a mammalian mitochondrial porphyrin transporter." Nature. 443(7111):586-589. PMID:17006453
  6. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  7. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  8. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  9. [ + ] Emadi-Konjin HP, et al. (2002) "Isolation of a genomic clone containing the promoter region of the human ATP binding cassette (ABC) transporter, ABCB6." Biochim Biophys Acta. 1574(2):117-130. PMID:11955620
  10. [ + ] Visapaa I, et al. (2002) "ABCB6 (MTABC3) excluded as the causative gene for the growth retardation syndrome with aminoaciduria, cholestasis, iron overload, and lactacidosis." Am J Med Genet. 109(3):202-205. PMID:11977179
  11. [ + ] Mitsuhashi N, et al. (2000) "MTABC3, a novel mitochondrial ATP-binding cassette protein involved in iron homeostasis." J Biol Chem. 275(23):17536-17540. PMID:10837493
  12. [ + ] Furuya KN, et al. (1997) "Identification of a new P-glycoprotein-like ATP-binding cassette transporter gene that is overexpressed during hepatocarcinogenesis." Cancer Res. 57(17):3708-3716. PMID:9288777
  13. [ + ] Yu W, et al. (1997) "Large-scale concatenation cDNA sequencing." Genome Res. 7(4):353-358. PMID:9110174
  14. [ + ] Andersson B, et al. (1996) "A "double adaptor" method for improved shotgun library construction." Anal Biochem. 236(1):107-113. PMID:8619474
  15. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702