ABCC5 | GeneID:10057 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 10057 Official Symbol ABCC5
Locus N/A Gene Type protein-coding
Synonyms ABC33; DKFZp686C1782; EST277145; MOAT-C; MOATC; MRP5; SMRP; pABC11
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Chromosome 3q27
Also Known As ATP-binding cassette, sub-family C, member 5; canalicular multispecific organic anion transporter C
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that this protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. This protein may be involved in resistance to thiopurines in acute lymphoblastic leukemia and antiretroviral nucleoside analogs in HIV-infected patients. Alternative splicing of this gene has been detected; however, the complete sequence and translation initiation site is unclear. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21164

ID Symbol Protein Species
GeneID:10057 ABCC5 NP_005679.2 Homo sapiens
GeneID:27416 Abcc5 NP_038818.2 Mus musculus
GeneID:116721 Abcc5 NP_446376.1 Rattus norvegicus
GeneID:181587 mrp-5 NP_510479.1 Caenorhabditis elegans
GeneID:424947 ABCC5 XP_422754.2 Gallus gallus
GeneID:478648 ABCC5 XP_857354.1 Canis lupus familiaris
GeneID:511769 ABCC5 XP_001251891.1 Bos taurus
GeneID:796249 LOC796249 XP_001333981.2 Danio rerio
GeneID:4329047 Os02g0288400 NP_001046583.1 Oryza sativa
GeneID:4329049 Os02g0288700 NP_001046585.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab49480 MRP5 antibody [69] - Cytoplasmic domain (ab49480); Mouse monoclonal [69] to MRP5 - Cytoplasmic domain
2 abcam ab24107 MRP5 antibody [M5II-54] (ab24107); Rat monoclonal [M5II-54] to MRP5
3 abcam ab3377 MRP5 antibody [M5I-1] (ab3377); Rat monoclonal [M5I-1] to MRP5
4 abnova H00010057-M06 ABCC5 monoclonal antibody (M06), clone 1B12; Mouse monoclonal antibody raised against a partial recombinant ABCC5.
5 acris AP16812PU-N ABCC5 / MRP5; antibody Ab
6 acris AP08593PU-N ABCC5 / MRP5 (N-term); antibody Ab
7 scbt ABCC5 ABCC5 Antibody / ABCC5 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCC5 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCC5 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0008514 Function organic anion transmembrane transporter activity
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001023587  UCSC Browser NP_001018881
2 NM_005688  UCSC Browser NP_005679

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000334444 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000334444 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000334444 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000334444 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000334444 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000334444 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000334444 MI0000433 hsa-let-7g UGAGGUAGUAGUUUGUACAGUU
ENST00000334444 MI0000434 hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENST00000334444 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENST00000334444 MI0000809 hsa-miR-151-3p CUAGACUGAAGCUCCUUGAGG
ENST00000334444 MI0000079 hsa-miR-23a AUCACAUUGCCAGGGAUUUCC
ENST00000334444 MI0000254 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000334444 MI0000736 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000334444 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENST00000334444 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENST00000334444 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENST00000334444 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENST00000334444 MI0003138 hsa-miR-497* CAAACCACACUGUGGUGUUAGA
ENST00000334444 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENST00000334444 MI0003169 hsa-miR-518e* CUCUAGAGGGAAGCGCUUUCUG
ENST00000334444 MI0003154 hsa-miR-518f* CUCUAGAGGGAAGCACUUUCUC
ENST00000334444 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENST00000334444 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENST00000334444 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENST00000334444 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENST00000334444 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENST00000334444 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENST00000334444 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENST00000334444 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENST00000382494 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENST00000382494 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000382494 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENST00000382494 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000382494 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000382494 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENST00000382494 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENST00000382494 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENST00000382494 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENST00000382494 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENST00000382494 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENST00000382494 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein
  • ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein
  • Quercetin inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
  • Silymarin inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
  • daidzein inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
  • hesperetin inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
  • naringenin inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
  • resveratrol inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
  • verlukast inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
16156793
3,4,5,3',4'-pentachlorobiphenyl
  • 3,4,5,3',4'-pentachlorobiphenyl results in decreased expression of ABCC5 mRNA
16260000
3,4,5,3',4'-pentachlorobiphenyl
  • [3,4,5,3',4'-pentachlorobiphenyl binds to AHR protein] which results in increased expression of ABCC5 mRNA
  • 3,4,5,3',4'-pentachlorobiphenyl results in increased expression of ABCC5 mRNA
15833929
Acetaminophen
  • Acetaminophen affects the expression of ABCC5 mRNA
17562736
Anticonvulsants
  • ABCC5 protein results in chemical resistance to Anticonvulsants
15581025
beta-Naphthoflavone
  • [beta-Naphthoflavone binds to AHR protein] which results in increased expression of ABCC5 mRNA
  • beta-Naphthoflavone results in increased expression of ABCC5 mRNA
15833929
Butylated Hydroxyanisole
  • [Butylated Hydroxyanisole results in increased activity of NFE2L2 protein] which results in increased expression of ABCC5 mRNA
  • Butylated Hydroxyanisole results in increased expression of ABCC5 mRNA
15833929
Cisplatin
  • ABCC5 mRNA results in chemical resistance to Cisplatin
15882455
Clofibric Acid
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCC5 mRNA
17602206
cyanoginosin LR
  • cyanoginosin LR results in increased expression of ABCC5 mRNA
17654400
Cycloheximide
  • Cycloheximide results in decreased expression of ABCC5 mRNA
  • [Cycloheximide co-treated with Estradiol] results in decreased expression of ABCC5 mRNA
15072547
daidzein
  • daidzein inhibits the reaction [ABCC5 protein results in chemical resistance to Thioguanine]
  • daidzein inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
16156793
dicyclanil
  • dicyclanil results in increased expression of ABCC5 mRNA
15664270
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCC5 mRNA
17602206
Estradiol
  • Estradiol results in decreased expression of ABCC5 mRNA
  • [Cycloheximide co-treated with Estradiol] results in decreased expression of ABCC5 mRNA
15072547
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ABCC5 mRNA
17557909
Ethoxyquin
  • [Ethoxyquin results in increased activity of NFE2L2 protein] which results in increased expression of ABCC5 mRNA
  • Ethoxyquin results in increased expression of ABCC5 mRNA
15833929
fulvestrant
  • fulvestrant results in decreased expression of ABCC5 mRNA
15072547
Glutathione
  • ABCC5 protein affects the export of Glutathione
15845416
hesperetin
  • hesperetin inhibits the reaction [ABCC5 protein results in chemical resistance to Thioguanine]
  • hesperetin inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
16156793
hydroxytamoxifen
  • hydroxytamoxifen results in increased expression of ABCC5 mRNA
15072547
Lipopolysaccharides
  • Lipopolysaccharides does not affect the expression of ABCC5 mRNA
15205389
naringenin
  • naringenin inhibits the reaction [ABCC5 protein results in chemical resistance to Thioguanine]
  • naringenin inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
16156793
nitrosobenzylmethylamine
  • nitrosobenzylmethylamine results in increased expression of ABCC5 mRNA
17616710
oltipraz
  • [oltipraz results in increased activity of NFE2L2 protein] which results in increased expression of ABCC5 mRNA
  • oltipraz results in increased expression of ABCC5 mRNA
15833929
Oncostatin M
  • Oncostatin M results in increased expression of ABCC5 mRNA
15654950
Phenobarbital
  • Phenobarbital results in decreased expression of ABCC5 mRNA
16260000
polyphenols
  • polyphenols results in increased expression of ABCC5 mRNA
16293270
Quercetin
  • ABCC5 protein results in chemical resistance to Quercetin
  • Quercetin inhibits the reaction [ABCC5 protein results in chemical resistance to Thioguanine]
  • Quercetin inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
16156793
resveratrol
  • ABCC5 protein results in chemical resistance to resveratrol
  • resveratrol inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
16156793
Silymarin
  • Silymarin inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
16156793
Soybean Oil
  • Soybean Oil affects the expression of ABCC5 mRNA
15770074
Tetrachlorodibenzodioxin
  • [Tetrachlorodibenzodioxin binds to AHR protein] which results in increased expression of ABCC5 mRNA
  • Tetrachlorodibenzodioxin results in increased expression of ABCC5 mRNA
15833929
Thioguanine
  • Quercetin inhibits the reaction [ABCC5 protein results in chemical resistance to Thioguanine]
  • daidzein inhibits the reaction [ABCC5 protein results in chemical resistance to Thioguanine]
  • hesperetin inhibits the reaction [ABCC5 protein results in chemical resistance to Thioguanine]
  • naringenin inhibits the reaction [ABCC5 protein results in chemical resistance to Thioguanine]
16156793
verlukast
  • verlukast inhibits the reaction [ABCC5 protein results in increased export of 2',7'-bis(carboxyethyl)-5(6)-carboxyfluorescein]
16156793
Zidovudine
  • Zidovudine results in increased expression of ABCC5 mRNA
  • ABCC5 protein results in increased export of Zidovudine
15456083

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Inflammation inferred via Silymarin 17213517
Liver Cirrhosis inferred via Silymarin 17213517
Liver Cirrhosis, Experimental inferred via Silymarin 15754394, 15864749, 18277467, 17198567
Liver Diseases inferred via Silymarin 17213517
Liver Diseases, Alcoholic inferred via Silymarin 17213517
Mushroom Poisoning inferred via Silymarin 17213517
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 16393696, 17534123
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17935668, 17164350, 16490592, 16267019, 17049120
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 17125593, 16525036, 16317513, 16456233, 17015251
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 16731767, 15767336, 17804756, 17718901, 17636462
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 17520802, 16314181, 15827377, 16317513
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Cadmium Poisoning inferred via Quercetin 16962696
Influenza, Human inferred via Quercetin 16624496
Kidney Diseases inferred via Quercetin 16962696
Liver Cirrhosis, Experimental inferred via Quercetin 12741479
Neurogenic Inflammation inferred via Quercetin 17929310
Pancreatic Neoplasms inferred via Quercetin 16965848
Colonic Neoplasms inferred via polyphenols 16293270
Inflammation inferred via polyphenols 16366677
Liver Diseases inferred via polyphenols 16698588
Dystonia inferred via Phenobarbital 1851702
Epilepsy, Absence inferred via Phenobarbital 6401628
Liver Neoplasms inferred via Phenobarbital 15975961, 8742319
Myoclonic Epilepsies, Progressive inferred via Phenobarbital 17484760
Osteomalacia inferred via Phenobarbital 17016548
Pancreatic Neoplasms inferred via Phenobarbital 16965848
Pseudolymphoma inferred via Phenobarbital 12752131
Seizures, Febrile inferred via Phenobarbital 6407741
Liver Cirrhosis, Experimental inferred via oltipraz 16544323
Esophageal Neoplasms inferred via nitrosobenzylmethylamine 16805852, 16704527, 15623463, 15150132, 15547721, 15264214, 15878914, 15547733, 16510608
Stomach Neoplasms inferred via nitrosobenzylmethylamine 17575124, 12958204
Liver Cirrhosis, Experimental inferred via naringenin 14709902
Liver Diseases inferred via naringenin 16945181
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
Carcinoma, Squamous Cell inferred via Glutathione 17015178
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17681005, 11677210, 15861022, 16105132, 17333356, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Breast Neoplasms inferred via Estradiol 17289903, 14630087, 12948864, 17261762, 18497071, 17018787
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11807958, 11408345, 16891317
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 17428255, 11831363, 10672840, 10737359
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 12112319, 10737359, 18648771, 16942905, 15885732
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 3124819, 16842330
Cardiovascular Diseases inferred via daidzein 16332659
Diabetes Mellitus, Type 2 inferred via daidzein 16647724
Hypertension inferred via daidzein 17169123
Hepatitis, Toxic inferred via cyanoginosin LR 17654400
Liver Neoplasms inferred via Clofibric Acid 17602206
Adenocarcinoma inferred via Cisplatin 11798837
Bone Marrow Neoplasms inferred via Cisplatin 14601052
Breast Neoplasms inferred via Cisplatin 18382427
Colorectal Neoplasms inferred via Cisplatin 15273666
Hodgkin Disease inferred via Cisplatin 16170182, 16200630
Kidney Failure, Acute inferred via Cisplatin 12690470
Lung Neoplasms inferred via Cisplatin 11798837, 17225452
Melanoma inferred via Cisplatin 16809738, 17023156, 18176117, 17761969, 12883367, 12393984, 12374674, 18332650, 15577323, 18505091, 16248763, 16432458
Melanoma, Amelanotic inferred via Cisplatin 15990972
Neoplasms inferred via Cisplatin 16773208
Ovarian Neoplasms inferred via Cisplatin 17225452
Sarcoma, Ewing's inferred via Cisplatin 14601052
Testicular Neoplasms inferred via Cisplatin 17225452
Urinary Bladder Neoplasms inferred via Cisplatin 12973940, 17225452
Vaginal Neoplasms inferred via Cisplatin 15577323
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17562736, 14986274, 16177239, 15968718, 16227642, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Adenoma, Liver Cell inferred via 3,4,5,3',4'-pentachlorobiphenyl 16628245
Cholangiocarcinoma inferred via 3,4,5,3',4'-pentachlorobiphenyl 16628245

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Gradilone A, et al. (2008) "Celecoxib upregulates multidrug resistance proteins in colon cancer: lack of synergy with standard chemotherapy." Curr Cancer Drug Targets. 8(5):414-420. PMID:18690847
  3. [ + ] Stojic J, et al. (2007) "Three novel ABCC5 splice variants in human retina and their role as regulators of ABCC5 gene expression." BMC Mol Biol. 8():42. PMID:17521428
  4. [ + ] Ravna AW, et al. (2007) "Molecular model of the outward facing state of the human P-glycoprotein (ABCB1), and comparison to a model of the human MRP5 (ABCC5)." Theor Biol Med Model. 4():33. PMID:17803828
  5. [ + ] Schulz T, et al. (2007) "Hyaluronan export by the ABC transporter MRP5 and its modulation by intracellular cGMP." J Biol Chem. 282(29):20999-21004. PMID:17540771
  6. [ + ] Konig J, et al. (2005) "Expression and localization of human multidrug resistance protein (ABCC) family members in pancreatic carcinoma." Int J Cancer. 115(3):359-367. PMID:15688370
  7. [ + ] Wu CP, et al. (2005) "Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5)." FEBS J. 272(18):4725-4740. PMID:16156793
  8. [ + ] Gwee PC, et al. (2005) "Strong linkage disequilibrium at the nucleotide analogue transporter ABCC5 gene locus." Pharmacogenet Genomics. 15(2):91-104. PMID:15861033
  9. [ + ] Meyer Zu Schwabedissen HE, et al. (2005) "Expression, localization, and function of MRP5 (ABCC5), a transporter for cyclic nucleotides, in human placenta and cultured human trophoblasts: effects of gestational age and cellular differentiation." Am J Pathol. 166(1):39-48. PMID:15631998
  10. [ + ] Jedlitschky G, et al. (2004) "The nucleotide transporter MRP4 (ABCC4) is highly expressed in human platelets and present in dense granules, indicating a role in mediator storage." Blood. 104(12):3603-3610. PMID:15297306
  11. [ + ] Brandenberger R, et al. (2004) "Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation." Nat Biotechnol. 22(6):707-716. PMID:15146197
  12. [ + ] Pascolo L, et al. (2003) "Effects of maturation on RNA transcription and protein expression of four MRP genes in human placenta and in BeWo cells." Biochem Biophys Res Commun. 303(1):259-265. PMID:12646196
  13. [ + ] Wielinga PR, et al. (2003) "Characterization of the MRP4- and MRP5-mediated transport of cyclic nucleotides from intact cells." J Biol Chem. 278(20):17664-17671. PMID:12637526
  14. [ + ] Reid G, et al. (2003) "Characterization of the transport of nucleoside analog drugs by the human multidrug resistance proteins MRP4 and MRP5." Mol Pharmacol. 63(5):1094-1103. PMID:12695538
  15. [ + ] Dazert P, et al. (2003) "Expression and localization of the multidrug resistance protein 5 (MRP5/ABCC5), a cellular export pump for cyclic nucleotides, in human heart." Am J Pathol. 163(4):1567-1577. PMID:14507663
  16. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  17. [ + ] Alcorn J, et al. (2002) "Transporter gene expression in lactating and nonlactating human mammary epithelial cells using real-time reverse transcription-polymerase chain reaction." J Pharmacol Exp Ther. 303(2):487-496. PMID:12388627
  18. [ + ] Wijnholds J, et al. (2000) "Multidrug-resistance protein 5 is a multispecific organic anion transporter able to transport nucleotide analogs." Proc Natl Acad Sci U S A. 97(13):7476-7481. PMID:10840050
  19. [ + ] Dias Neto E, et al. (2000) "Shotgun sequencing of the human transcriptome with ORF expressed sequence tags." Proc Natl Acad Sci U S A. 97(7):3491-3496. PMID:10737800
  20. [ + ] Jedlitschky G, et al. (2000) "The multidrug resistance protein 5 functions as an ATP-dependent export pump for cyclic nucleotides." J Biol Chem. 275(39):30069-30074. PMID:10893247
  21. [ + ] Oguri T, et al. (2000) "Increased expression of the MRP5 gene is associated with exposure to platinum drugs in lung cancer." Int J Cancer. 86(1):95-100. PMID:10728601
  22. [ + ] Suzuki T, et al. (2000) "Detailed structural analysis on both human MRP5 and mouse mrp5 transcripts." Gene. 242(1-2):167-173. PMID:10721709
  23. [ + ] Cole SP, et al. (1999) "Re: Characterization of MOAT-C and MOAT-D, new members of the MRP/cMOAT subfamily of transporter proteins." J Natl Cancer Inst. 91(10):888-889. PMID:10340910
  24. [ + ] McAleer MA, et al. (1999) "pABC11 (also known as MOAT-C and MRP5), a member of the ABC family of proteins, has anion transporter activity but does not confer multidrug resistance when overexpressed in human embryonic kidney 293 cells." J Biol Chem. 274(33):23541-23548. PMID:10438534
  25. [ + ] Belinsky MG, et al. (1998) "Characterization of MOAT-C and MOAT-D, new members of the MRP/cMOAT subfamily of transporter proteins." J Natl Cancer Inst. 90(22):1735-1741. PMID:9827529
  26. [ + ] Suzuki T, et al. (1997) "cDNA cloning of a short type of multidrug resistance protein homologue, SMRP, from a human lung cancer cell line." Biochem Biophys Res Commun. 238(3):790-794. PMID:9325169
  27. [ + ] Kool M, et al. (1997) "Analysis of expression of cMOAT (MRP2), MRP3, MRP4, and MRP5, homologues of the multidrug resistance-associated protein gene (MRP1), in human cancer cell lines." Cancer Res. 57(16):3537-3547. PMID:9270026
  28. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702