100041354 | GeneID:100041354 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 100041354 Official Symbol 100041354
Locus N/A Gene Type protein-coding
Synonyms
Full Name predicted gene, 100041354
Description predicted gene, 100041354
Chromosome 5 E3|5
Also Known As hypothetical protein LOC100041354
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 103898

ID Symbol Protein Species
GeneID:320549 D5Ertd577e NP_796161.1 Mus musculus
GeneID:381654 C87414 XP_001475899.1 Mus musculus
GeneID:545762 AU018829 NP_001026793.1 Mus musculus
GeneID:665290 LOC665290 XP_982246.1 Mus musculus
GeneID:665718 LOC665718 XP_001487848.1 Mus musculus
GeneID:665802 EG665802 XP_986985.1 Mus musculus
GeneID:665943 E330014E10Rik XP_987602.1 Mus musculus
GeneID:100038995 LOC100038995 XP_001472106.1 Mus musculus
GeneID:100039010 LOC100039010 XP_001472219.1 Mus musculus
GeneID:100040112 LOC100040112 XP_001474300.1 Mus musculus
GeneID:100040125 LOC100040125 XP_001474377.1 Mus musculus
GeneID:100040885 LOC100040885 XP_001475817.1 Mus musculus
GeneID:100041032 100041032 XP_001476166.1 Mus musculus
GeneID:100041102 100041102 XP_001476290.1 Mus musculus
GeneID:100041179 100041179 XP_001476464.1 Mus musculus
GeneID:100041253 LOC100041253 XP_001476555.1 Mus musculus
GeneID:100041296 100041296 XP_001476624.1 Mus musculus
GeneID:100041354 100041354 XP_001476843.1 Mus musculus
GeneID:100041641 LOC100041641 XP_001473615.1 Mus musculus
GeneID:100041712 LOC100041712 XP_001473761.1 Mus musculus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001122678  UCSC Browser NP_001116150
2 XM_001476772  UCSC Browser XP_001476822
3 XM_001476793  UCSC Browser XP_001476843
4 XM_001476810  UCSC Browser XP_001476860
5 XM_001476832  UCSC Browser XP_001476882

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000071182 MI0000158 mmu-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSMUST00000071182 MI0001162 mmu-miR-376b* GUGGAUAUUCCUUCUAUGGUUA
ENSMUST00000071182 MI0003533 mmu-miR-376c* GUGGAUAUUCCUUCUAUGUUUA
ENSMUST00000071182 MI0001160 mmu-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENSMUST00000097489 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENSMUST00000097489 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSMUST00000097489 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENSMUST00000097489 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSMUST00000097489 MI0000556 mmu-let-7a* CUAUACAAUCUACUGUCUUUCC
ENSMUST00000097489 MI0000558 mmu-let-7b* CUAUACAACCUACUGCCUUCCC
ENSMUST00000097489 MI0000559 mmu-let-7c-1* CUGUACAACCUUCUAGCUUUCC
ENSMUST00000097489 MI0000562 mmu-let-7f* CUAUACAAUCUAUUGCCUUCCC
ENSMUST00000097489 MI0000158 mmu-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSMUST00000097489 MI0000229 mmu-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENSMUST00000097489 MI0000696 mmu-miR-212 UAACAGUCUCCAGUCACGGCCA
ENSMUST00000097489 MI0000711 mmu-miR-224 UAAGUCACUAGUGGUUCCGUU
ENSMUST00000097489 MI0000578 mmu-miR-27a UUCACAGUGGCUAAGUUCCGC
ENSMUST00000097489 MI0000142 mmu-miR-27b UUCACAGUGGCUAAGUUCUGC
ENSMUST00000097489 MI0000144 mmu-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENSMUST00000097489 MI0000547 mmu-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC
ENSMUST00000097489 MI0000259 mmu-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENSMUST00000097489 MI0000609 mmu-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENSMUST00000097489 MI0000621 mmu-miR-339-3p UGAGCGCCUCGGCGACAGAGCCG
ENSMUST00000097489 MI0000623 mmu-miR-340-3p UCCGUCUCAGUUACUUUAUAGC
ENSMUST00000097489 MI0000623 mmu-miR-340-5p UUAUAAAGCAAUGAGACUGAUU
ENSMUST00000097489 MI0001649 mmu-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENSMUST00000097489 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSMUST00000097489 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSMUST00000097489 MI0005515 mmu-miR-504 AGACCCUGGUCUGCACUCUAUC
ENSMUST00000097489 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSMUST00000097489 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENSMUST00000097489 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA
ENSMUST00000097490 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENSMUST00000097490 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENSMUST00000097490 MI0000142 mmu-miR-27b UUCACAGUGGCUAAGUUCUGC
ENSMUST00000097490 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  4. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  5. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  6. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  7. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636