100038993 | GeneID:100038993 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 100038993 Official Symbol 100038993
Locus N/A Gene Type protein-coding
Synonyms MGC164180
Full Name predicted gene, 100038993
Description predicted gene, 100038993
Chromosome 4 A5|4
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 88705

ID Symbol Protein Species
GeneID:3590 IL11RA NP_004503.1 Homo sapiens
GeneID:16157 Il11ra1 NP_034679.1 Mus musculus
GeneID:16158 Il11ra2 NP_034680.2 Mus musculus
GeneID:245983 Il11ra1 NP_620816.1 Rattus norvegicus
GeneID:334010 il11ra NP_001106971.1 Danio rerio
GeneID:481588 IL11RA XP_538710.2 Canis lupus familiaris
GeneID:508932 IL11RA NP_001029511.1 Bos taurus
GeneID:556326 LOC556326 NP_001092916.1 Danio rerio
GeneID:693251 IL11RA NP_001038139.1 Gallus gallus
GeneID:100038993 LOC100038993 XP_001472104.1 Mus musculus
GeneID:100042555 RP23-388P16.3 XP_001478667.1 Mus musculus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0004872 Function receptor activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001100596  UCSC Browser NP_001094066
2 XM_001472054  UCSC Browser XP_001472104

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000084667 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSMUST00000084667 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSMUST00000084667 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSMUST00000084667 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSMUST00000084667 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENSMUST00000084667 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENSMUST00000084667 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSMUST00000084667 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSMUST00000084667 MI0000567 mmu-miR-18a* ACUGCCCUAAGUGCUCCUUCUG
ENSMUST00000084667 MI0000702 mmu-miR-219 UGAUUGUCCAAACGCAAUUCU
ENSMUST00000084667 MI0000741 mmu-miR-219 UGAUUGUCCAAACGCAAUUCU
ENSMUST00000084667 MI0000621 mmu-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENSMUST00000084667 MI0000623 mmu-miR-340-3p UCCGUCUCAGUUACUUUAUAGC
ENSMUST00000084667 MI0004637 mmu-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENSMUST00000084667 MI0004637 mmu-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENSMUST00000084667 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSMUST00000084667 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENSMUST00000084667 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSMUST00000084667 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSMUST00000084667 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSMUST00000084667 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSMUST00000084667 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENSMUST00000084667 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSMUST00000084667 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENSMUST00000084667 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENSMUST00000084667 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSMUST00000084667 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSMUST00000084667 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSMUST00000084667 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSMUST00000084667 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSMUST00000084667 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSMUST00000084667 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSMUST00000084667 MI0005554 mmu-miR-511 AUGCCUUUUGCUCUGCACUCA
ENSMUST00000084667 MI0004692 mmu-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENSMUST00000098121 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSMUST00000098121 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSMUST00000098121 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSMUST00000098121 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSMUST00000098121 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENSMUST00000098121 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENSMUST00000098121 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSMUST00000098121 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSMUST00000098121 MI0000567 mmu-miR-18a* ACUGCCCUAAGUGCUCCUUCUG
ENSMUST00000098121 MI0000702 mmu-miR-219 UGAUUGUCCAAACGCAAUUCU
ENSMUST00000098121 MI0000741 mmu-miR-219 UGAUUGUCCAAACGCAAUUCU
ENSMUST00000098121 MI0000621 mmu-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENSMUST00000098121 MI0000623 mmu-miR-340-3p UCCGUCUCAGUUACUUUAUAGC
ENSMUST00000098121 MI0004637 mmu-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENSMUST00000098121 MI0004637 mmu-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENSMUST00000098121 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSMUST00000098121 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENSMUST00000098121 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSMUST00000098121 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSMUST00000098121 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSMUST00000098121 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSMUST00000098121 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENSMUST00000098121 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSMUST00000098121 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENSMUST00000098121 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENSMUST00000098121 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSMUST00000098121 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSMUST00000098121 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSMUST00000098121 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSMUST00000098121 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSMUST00000098121 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSMUST00000098121 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSMUST00000098121 MI0005554 mmu-miR-511 AUGCCUUUUGCUCUGCACUCA
ENSMUST00000098121 MI0004692 mmu-miR-708 AAGGAGCUUACAAUCUAGCUGGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932