a2ml | GeneID:100006972 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 100006972 Official Symbol a2ml
Locus N/A Gene Type protein-coding
Synonyms
Full Name alpha-2 macroglobulin-like
Description alpha-2 macroglobulin-like
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37248

ID Symbol Protein Species
GeneID:2 A2M NP_000005.2 Homo sapiens
GeneID:24153 A2m NP_036620.1 Rattus norvegicus
GeneID:232345 A2m NP_783327.1 Mus musculus
GeneID:418251 A2M XP_416476.2 Gallus gallus
GeneID:465372 A2M XP_001139819.1 Pan troglodytes
GeneID:477699 A2M XP_534893.2 Canis lupus familiaris
GeneID:513856 A2M XP_591612.3 Bos taurus
GeneID:562067 LOC562067 XP_001922903.1 Danio rerio
GeneID:569025 LOC569025 XP_697477.3 Danio rerio
GeneID:793035 zgc:171445 NP_001107101.1 Danio rerio
GeneID:793100 LOC793100 XP_001332356.1 Danio rerio
GeneID:100003785 LOC100003785 XP_001921519.1 Danio rerio
GeneID:100006782 LOC100006782 XP_001345438.2 Danio rerio
GeneID:100006895 LOC100006895 XP_001923676.1 Danio rerio
GeneID:100006925 LOC100006925 XP_001921577.1 Danio rerio
GeneID:100006947 sb:cb37 XP_001345541.2 Danio rerio
GeneID:100006972 LOC100006972 XP_001345556.2 Danio rerio
GeneID:100006993 wu:fb68b01 XP_001345569.2 Danio rerio
GeneID:100101650 zgc:165518 NP_001093623.1 Danio rerio
GeneID:100136837 zgc:171446 NP_001108028.1 Danio rerio
GeneID:100137103 zgc:171426 NP_001108172.1 Danio rerio
GeneID:100137119 si:dkey-46g23.3 NP_001108188.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0005615 Component extracellular space
GO:0004866 Function endopeptidase inhibitor activity
GO:0005515 Function protein binding
GO:0001889 Process liver development

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001139479 NP_001132951
2 XM_001345520 XP_001345556

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000078734 MI0001877 dre-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSDART00000078734 MI0001878 dre-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSDART00000078734 MI0004770 dre-miR-726 UUCACUACUAGCAGAACUCGG
ENSDART00000078734 MI0004780 dre-miR-734 GUAAAUGCUGCAGAAUCGUACCG
ENSDART00000078734 MI0004878 xtr-miR-302 UAAGUGCUCCAAUGUUUUAGUGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932