A1BG | GeneID:1 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 1 Official Symbol A1BG
Locus N/A Gene Type protein-coding
Synonyms A1B; ABG; DKFZp686F0970; GAB; HYST2477
Full Name alpha-1-B glycoprotein
Description alpha-1-B glycoprotein
Chromosome 19q13.4
Also Known As alpha 1B-glycoprotein
Summary The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11167

ID Symbol Protein Species
GeneID:1 A1BG NP_570602.2 Homo sapiens
GeneID:117586 A1bg NP_001074536.1 Mus musculus
GeneID:140656 A1bg NP_071594.2 Rattus norvegicus
GeneID:484230 A1BG XP_541346.2 Canis lupus familiaris
GeneID:518955 A1BG NP_001039708.1 Bos taurus
GeneID:742390 A1BG XP_001146598.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab70782 A1BG antibody [51A6] (ab70782); Mouse monoclonal [51A6] to A1BG
2 abcam ab66011 A1BG antibody (ab66011); Rabbit polyclonal to A1BG
3 abnova H00000001-M02 A1BG monoclonal antibody (M02), clone 4F6; Mouse monoclonal antibody raised against a full length recombinant A1BG.
4 abnova MAB0794 A1BG monoclonal antibody, clone 54B12; Mouse monoclonal antibody raised against a native A1BG.
5 abnova H00000001-M15 A1BG monoclonal antibody (M15), clone 1H1; Mouse monoclonal antibody raised against a full length recombinant A1BG.
6 abnova MAB0821 A1BG monoclonal antibody, clone 51A6; Mouse monoclonal antibody raised against a native A1BG.
7 scbt A1BG A1BG Antibody / A1BG Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of A1BG Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of A1BG Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_130786  UCSC Browser NP_570602

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000263100 MI0000460 hsa-miR-144* GGAUAUCAUCAUAUACUGUAAG
ENST00000263100 MI0000775 hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENST00000263100 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENST00000263100 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENST00000263100 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of A1BG mRNA
15953391

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 17333356, 17681005, 16105132, 11677210, 15861022
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
CRISP3 CRISP3 / A1BG Affinity Capture-MS Udby L (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Liu T, et al. (2005) "Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry." J Proteome Res. 4(6):2070-2080. PMID:16335952
  2. [ + ] Bunkenborg J, et al. (2004) "Screening for N-glycosylated proteins by liquid chromatography mass spectrometry." Proteomics. 4(2):454-465. PMID:14760718
  3. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  4. [ + ] Yamada S, et al. (2004) "Expression profiling and differential screening between hepatoblastomas and the corresponding normal livers: identification of high expression of the PLK1 oncogene as a poor-prognostic indicator of hepatoblastomas." Oncogene. 23(35):5901-5911. PMID:15221005
  5. [ + ] Udby L, et al. (2004) "Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma." Biochemistry. 43(40):12877-12886. PMID:15461460
  6. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  8. [ + ] Hillier LD, et al. (1996) "Generation and analysis of 280,000 human expressed sequence tags." Genome Res. 6(9):807-828. PMID:8889549
  9. [ + ] Eiberg H, et al. (1989) "Linkage between alpha 1B-glycoprotein (A1BG) and Lutheran (LU) red blood group system: assignment to chromosome 19: new genetic variants of A1BG." Clin Genet. 36(6):415-418. PMID:2591067
  10. [ + ] Gahne B, et al. (1987) "Genetic polymorphism of human plasma alpha 1B-glycoprotein: phenotyping by immunoblotting or by a simple method of 2-D electrophoresis." Hum Genet. 76(2):111-115. PMID:3610142
  11. [ + ] Ishioka N, et al. (1986) "Amino acid sequence of human plasma alpha 1B-glycoprotein: homology to the immunoglobulin supergene family." Proc Natl Acad Sci U S A. 83(8):2363-2367. PMID:3458201